ID: 1031647740

View in Genome Browser
Species Human (GRCh38)
Location 7:124247460-124247482
Sequence GAGGGTAGAGGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031647740_1031647747 -10 Left 1031647740 7:124247460-124247482 CCCTCCTCCTTCCCTCTACCCTC No data
Right 1031647747 7:124247473-124247495 CTCTACCCTCAAGTAGGCCCCGG 0: 19
1: 160
2: 333
3: 437
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031647740 Original CRISPR GAGGGTAGAGGGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr