ID: 1031648391

View in Genome Browser
Species Human (GRCh38)
Location 7:124255230-124255252
Sequence AGTTTAGTACAGGGAATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031648391_1031648398 21 Left 1031648391 7:124255230-124255252 CCCAGCATTCCCTGTACTAAACT No data
Right 1031648398 7:124255274-124255296 TGTAAAAATGCTGTCTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031648391 Original CRISPR AGTTTAGTACAGGGAATGCT GGG (reversed) Intergenic
No off target data available for this crispr