ID: 1031648395

View in Genome Browser
Species Human (GRCh38)
Location 7:124255239-124255261
Sequence CTTACCCTTAGTTTAGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031648395_1031648398 12 Left 1031648395 7:124255239-124255261 CCCTGTACTAAACTAAGGGTAAG No data
Right 1031648398 7:124255274-124255296 TGTAAAAATGCTGTCTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031648395 Original CRISPR CTTACCCTTAGTTTAGTACA GGG (reversed) Intergenic
No off target data available for this crispr