ID: 1031648398

View in Genome Browser
Species Human (GRCh38)
Location 7:124255274-124255296
Sequence TGTAAAAATGCTGTCTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031648396_1031648398 11 Left 1031648396 7:124255240-124255262 CCTGTACTAAACTAAGGGTAAGT No data
Right 1031648398 7:124255274-124255296 TGTAAAAATGCTGTCTATTTAGG No data
1031648392_1031648398 20 Left 1031648392 7:124255231-124255253 CCAGCATTCCCTGTACTAAACTA No data
Right 1031648398 7:124255274-124255296 TGTAAAAATGCTGTCTATTTAGG No data
1031648391_1031648398 21 Left 1031648391 7:124255230-124255252 CCCAGCATTCCCTGTACTAAACT No data
Right 1031648398 7:124255274-124255296 TGTAAAAATGCTGTCTATTTAGG No data
1031648395_1031648398 12 Left 1031648395 7:124255239-124255261 CCCTGTACTAAACTAAGGGTAAG No data
Right 1031648398 7:124255274-124255296 TGTAAAAATGCTGTCTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031648398 Original CRISPR TGTAAAAATGCTGTCTATTT AGG Intergenic
No off target data available for this crispr