ID: 1031654930

View in Genome Browser
Species Human (GRCh38)
Location 7:124343149-124343171
Sequence CCTCTTCACCACACACTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031654925_1031654930 -10 Left 1031654925 7:124343136-124343158 CCTTTCAGTTCTCCCTCTTCACC No data
Right 1031654930 7:124343149-124343171 CCTCTTCACCACACACTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031654930 Original CRISPR CCTCTTCACCACACACTGTG GGG Intergenic
No off target data available for this crispr