ID: 1031655486

View in Genome Browser
Species Human (GRCh38)
Location 7:124349647-124349669
Sequence GCGGGAAAGCTGCCAGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031655478_1031655486 28 Left 1031655478 7:124349596-124349618 CCAGAGGGATTATGGCTGCCTCT 0: 9
1: 121
2: 204
3: 187
4: 225
Right 1031655486 7:124349647-124349669 GCGGGAAAGCTGCCAGTCACAGG No data
1031655480_1031655486 10 Left 1031655480 7:124349614-124349636 CCTCTGCTGAGTCATACAGGTCA 0: 26
1: 66
2: 116
3: 329
4: 544
Right 1031655486 7:124349647-124349669 GCGGGAAAGCTGCCAGTCACAGG No data
1031655477_1031655486 29 Left 1031655477 7:124349595-124349617 CCCAGAGGGATTATGGCTGCCTC 0: 10
1: 127
2: 391
3: 386
4: 334
Right 1031655486 7:124349647-124349669 GCGGGAAAGCTGCCAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031655486 Original CRISPR GCGGGAAAGCTGCCAGTCAC AGG Intergenic
No off target data available for this crispr