ID: 1031655795

View in Genome Browser
Species Human (GRCh38)
Location 7:124353270-124353292
Sequence TAAGACTTAAGATAAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031655794_1031655795 0 Left 1031655794 7:124353247-124353269 CCTGGTAATCAAGACTCTGAAAA No data
Right 1031655795 7:124353270-124353292 TAAGACTTAAGATAAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031655795 Original CRISPR TAAGACTTAAGATAAAAGAC TGG Intergenic
No off target data available for this crispr