ID: 1031660538

View in Genome Browser
Species Human (GRCh38)
Location 7:124418833-124418855
Sequence GCAAGATTACCTCAGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031660538_1031660540 14 Left 1031660538 7:124418833-124418855 CCACATGGCTGAGGTAATCTTGC No data
Right 1031660540 7:124418870-124418892 TATAAGGCTCTAGACTTCAATGG No data
1031660538_1031660539 -2 Left 1031660538 7:124418833-124418855 CCACATGGCTGAGGTAATCTTGC No data
Right 1031660539 7:124418854-124418876 GCATTATATGCTCAGCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031660538 Original CRISPR GCAAGATTACCTCAGCCATG TGG (reversed) Intergenic
No off target data available for this crispr