ID: 1031665806

View in Genome Browser
Species Human (GRCh38)
Location 7:124480966-124480988
Sequence CATTCTCGGGGCCATCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031665797_1031665806 22 Left 1031665797 7:124480921-124480943 CCACGTCGATCTGGGTGTTAAGT 0: 1
1: 16
2: 11
3: 10
4: 24
Right 1031665806 7:124480966-124480988 CATTCTCGGGGCCATCATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 85
1031665801_1031665806 -4 Left 1031665801 7:124480947-124480969 CCAAGGAGGTGGTCACTGCCATT 0: 1
1: 0
2: 13
3: 47
4: 308
Right 1031665806 7:124480966-124480988 CATTCTCGGGGCCATCATTCTGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031665806 Original CRISPR CATTCTCGGGGCCATCATTC TGG Intergenic
900510460 1:3057339-3057361 CATTCTAGGGCACATCATTGTGG + Intergenic
903369239 1:22824626-22824648 CCTTCTCCGGGGCTTCATTCTGG - Intronic
903938086 1:26910503-26910525 CAGTCTAGGCGTCATCATTCAGG - Intronic
905485255 1:38291676-38291698 CATGCTCTAGGCCAACATTCTGG - Intergenic
905694221 1:39962996-39963018 CATCCGTGGGGCCATCATCCTGG + Intronic
907040028 1:51251008-51251030 CATCCATGGGGCCATCATCCTGG - Intronic
915995002 1:160553218-160553240 CATCCTCAGAGCCATCATTCTGG + Intronic
916523040 1:165582046-165582068 CATCCACAGGGCCATCATCCTGG + Intergenic
916819788 1:168387091-168387113 CATTCGCGTGGGGATCATTCGGG + Intergenic
1067788744 10:49271946-49271968 CTTTTTGGGGGCCACCATTCAGG - Intergenic
1069910059 10:71753520-71753542 CATTCTAGGGGACATCTCTCAGG + Intronic
1072487975 10:95874556-95874578 CATTCTGGGGTCTACCATTCTGG + Exonic
1073612357 10:104957075-104957097 CCTTCTCAGGTACATCATTCAGG + Intronic
1077167002 11:1146810-1146832 CATCTCTGGGGCCATCATTCAGG + Intergenic
1079058642 11:17228719-17228741 CATCCGTGGGGCCATCATCCTGG + Intronic
1089736077 11:120551032-120551054 CCTTCTCAAGGCCTTCATTCTGG - Intronic
1091100523 11:132868745-132868767 CATCCTCTGGCCCATCATCCTGG - Intronic
1092676911 12:10930753-10930775 CCTGCTGAGGGCCATCATTCTGG - Exonic
1093135075 12:15439972-15439994 CATCTGCGGGGCCATCATCCTGG + Intronic
1093689073 12:22089081-22089103 CATTCTCTGGGCAATGATCCAGG + Intronic
1093916407 12:24807064-24807086 CATTCTCGGGGCATAGATTCAGG + Intergenic
1101074106 12:101110249-101110271 CAGTCTCCTGGCCATCTTTCTGG + Intronic
1103107917 12:118246533-118246555 CATCCGTGGGGCCATCATCCTGG + Intronic
1118507432 14:66428827-66428849 TATTCTCGTGGCTATCATTTGGG - Intergenic
1118708771 14:68502902-68502924 CATTCTAGGGGGCATCTTTCAGG + Intronic
1119403152 14:74378133-74378155 CATCTGCGGGGCCATCATCCTGG - Intergenic
1122912210 14:104836404-104836426 CATCCGTGGGGCCATCATCCTGG - Intergenic
1125805841 15:42492890-42492912 TAAACTCTGGGCCATCATTCAGG + Intronic
1129035987 15:72648610-72648632 CATTCTGGGGGGCATCTTCCAGG + Intergenic
1129213898 15:74088606-74088628 CATTCTGGGGGGCATCTTCCAGG - Intergenic
1129400114 15:75276757-75276779 CATTCTGGGGGGCATCTTCCAGG + Intronic
1132837727 16:1962813-1962835 CATCCGTGGGGCCATCATCCTGG - Exonic
1137451403 16:48577934-48577956 CGTCCGAGGGGCCATCATTCTGG - Intronic
1140509352 16:75495741-75495763 CACTCTCGGGGGCATCCTTGCGG + Intergenic
1141916340 16:87099741-87099763 CATCTTAGGGGCCATTATTCAGG - Intronic
1145022942 17:19446380-19446402 CATCCGTGGGGCCATCATCCTGG - Intergenic
1146899637 17:36574869-36574891 CATCCACGGGGCCATCATCCTGG - Intronic
1146978874 17:37141008-37141030 CATCCATGGGGCCATCATCCTGG - Intronic
1149166310 17:53757399-53757421 CATCCGTGGGGCCATCATCCTGG - Intergenic
1150853885 17:68732204-68732226 TATTCTGGGGGCAAGCATTCTGG + Intergenic
1153355019 18:4124949-4124971 CATGCTCGAGGCCCTGATTCCGG - Intronic
1155322065 18:24629488-24629510 CATTCACCCGGCCATCCTTCTGG - Intergenic
1159601261 18:70430689-70430711 CATCCGCGGGGCCATTATCCTGG + Intergenic
1160742008 19:690757-690779 CATCATCGGGGCCGTCATCCTGG + Intronic
1162674020 19:12284753-12284775 CATCCGCGGGGCCATCATCCTGG + Intronic
1162923889 19:13919906-13919928 CATCCTCTGGGCCTTCATCCTGG - Exonic
1163295995 19:16413144-16413166 CATCCGCAGGGCCATCATACTGG + Intronic
926023447 2:9517519-9517541 CTTTCTCAGTGCCATCATTTTGG - Intronic
928177919 2:29047583-29047605 CCTTCTGGGGGCCAGCATGCGGG - Intronic
933659556 2:84916233-84916255 CATCCGTGGGGCCATCATCCTGG + Intergenic
944044272 2:195390658-195390680 CATTTTGGGGGCCATTTTTCTGG - Intergenic
1168968502 20:1914665-1914687 CCTTCTCGGGGCCTGCATCCTGG + Intronic
1172975805 20:38904917-38904939 CATTCTCATGGTCATCATTTAGG + Intronic
1173768949 20:45640899-45640921 CATCCGTGGGGCCATCATCCTGG - Intergenic
1173972138 20:47161256-47161278 CATCCGCGGGGCCATCATCCTGG - Intronic
1175407069 20:58741771-58741793 CATCCTCTGTGCCATCCTTCAGG - Intergenic
949879918 3:8653071-8653093 CATTCTTGTGGCTATCATTTCGG - Intronic
952891939 3:38048906-38048928 CATTATCTGGGCCACCATTGAGG - Intronic
959034858 3:101349264-101349286 CATTCTGAGGGCTCTCATTCTGG - Intronic
964874304 3:161348396-161348418 CTTTCTCAAGGCCATCATTAAGG - Intronic
966850912 3:184164579-184164601 CATGCTCTGGGCCATCCCTCCGG - Exonic
974039785 4:56847452-56847474 CATTCTCTCTGCCTTCATTCTGG - Intergenic
988695138 5:33614307-33614329 CATTGTCAAGGCCATCTTTCTGG + Exonic
992357927 5:76004732-76004754 TATTCGCGGGGTCATCATGCAGG - Intergenic
992741137 5:79774647-79774669 CACTCCCGGGGCCATCCTCCAGG + Intronic
995732920 5:115265058-115265080 CATCTGCGGGGCCATCATCCTGG - Intergenic
997419980 5:133758740-133758762 CATTCTAGGGGTCAACATTTTGG + Intergenic
998337950 5:141389984-141390006 CTTCCTCGTGGCCATGATTCTGG + Exonic
998690391 5:144581210-144581232 CATTTTCAGGGCCATCATTTTGG - Intergenic
1000393346 5:160747938-160747960 CATCCTGGGAGCCATCAGTCTGG - Intronic
1000992975 5:167929656-167929678 CATTCTATGGGCAATCTTTCTGG - Intronic
1001467848 5:171984504-171984526 CATTACCGGTGCCATTATTCTGG - Intronic
1002820444 6:719732-719754 CACTGTCGGTGCCCTCATTCAGG + Intergenic
1012543688 6:100392950-100392972 CACTCACGGGGTCATCATTGTGG + Intronic
1019665392 7:2249710-2249732 CATTCTAGGGGACATCCTCCTGG + Intronic
1023907560 7:44533331-44533353 CATTCTCTGGGCCATCTCTGTGG + Intronic
1026082987 7:67238844-67238866 CACTCTCGGGACTAGCATTCTGG - Exonic
1031665806 7:124480966-124480988 CATTCTCGGGGCCATCATTCTGG + Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1039375578 8:37029436-37029458 CATTCTGGAGGCAAACATTCTGG + Intergenic
1041175482 8:55192710-55192732 TAATCTCGGGGTCATTATTCTGG + Intronic
1049321833 8:142000836-142000858 AATGCTGGGGGCCCTCATTCTGG + Intergenic
1186008022 X:5095888-5095910 CATTCTCAGGACCAGCATCCAGG + Intergenic
1189429655 X:40935392-40935414 CATCCGTGGGGCCATCATCCTGG - Intergenic
1190708120 X:53047899-53047921 CTTTCTCGGGGCCAGCAGACAGG - Intergenic
1190950198 X:55136003-55136025 CATTCTGGAGGCCATCCTACGGG + Intronic
1193633268 X:83916523-83916545 CATACTAGGGCCCATCTTTCAGG + Intergenic
1198791047 X:140346594-140346616 CATTCCCTGGGCCTTCATACTGG + Intergenic
1199803678 X:151275995-151276017 CATTCTCAGGGCAATCAGGCAGG + Intergenic
1200298732 X:154950211-154950233 AATTCTAGGGGACATGATTCAGG + Intronic
1200865275 Y:8036887-8036909 TATTTTTGGGCCCATCATTCAGG + Intergenic
1201672387 Y:16538466-16538488 CATTCTCAGGACCTACATTCAGG - Intergenic