ID: 1031669463

View in Genome Browser
Species Human (GRCh38)
Location 7:124525134-124525156
Sequence GGGTGCACACGTGTTTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031669462_1031669463 -4 Left 1031669462 7:124525115-124525137 CCACTGCATCAGTGTGGTGGGGT No data
Right 1031669463 7:124525134-124525156 GGGTGCACACGTGTTTGCTGTGG No data
1031669456_1031669463 20 Left 1031669456 7:124525091-124525113 CCCATGTTTTCTCACACATACTA No data
Right 1031669463 7:124525134-124525156 GGGTGCACACGTGTTTGCTGTGG No data
1031669457_1031669463 19 Left 1031669457 7:124525092-124525114 CCATGTTTTCTCACACATACTAG No data
Right 1031669463 7:124525134-124525156 GGGTGCACACGTGTTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031669463 Original CRISPR GGGTGCACACGTGTTTGCTG TGG Intergenic
No off target data available for this crispr