ID: 1031676478

View in Genome Browser
Species Human (GRCh38)
Location 7:124617668-124617690
Sequence GAGAGTTATACCCCTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031676478_1031676482 -3 Left 1031676478 7:124617668-124617690 CCTACCCCAGGGGTATAACTCTC No data
Right 1031676482 7:124617688-124617710 CTCCAGCTTTGACTCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031676478 Original CRISPR GAGAGTTATACCCCTGGGGT AGG (reversed) Intergenic
No off target data available for this crispr