ID: 1031676555

View in Genome Browser
Species Human (GRCh38)
Location 7:124618320-124618342
Sequence AGTTATCTGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031676555_1031676557 19 Left 1031676555 7:124618320-124618342 CCTGCCATTTTCTGCAGATAACT No data
Right 1031676557 7:124618362-124618384 TTTTTTTGAGAGACAGCTCTTGG No data
1031676555_1031676558 30 Left 1031676555 7:124618320-124618342 CCTGCCATTTTCTGCAGATAACT No data
Right 1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031676555 Original CRISPR AGTTATCTGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr