ID: 1031678543

View in Genome Browser
Species Human (GRCh38)
Location 7:124641639-124641661
Sequence TCCTGTCACTAAAGGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031678543_1031678548 0 Left 1031678543 7:124641639-124641661 CCTAGATCCCTTTAGTGACAGGA No data
Right 1031678548 7:124641662-124641684 GTGGGTGAGAGCCTAGACTGTGG No data
1031678543_1031678551 15 Left 1031678543 7:124641639-124641661 CCTAGATCCCTTTAGTGACAGGA No data
Right 1031678551 7:124641677-124641699 GACTGTGGAGCTAGACTGCAGGG No data
1031678543_1031678550 14 Left 1031678543 7:124641639-124641661 CCTAGATCCCTTTAGTGACAGGA No data
Right 1031678550 7:124641676-124641698 AGACTGTGGAGCTAGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031678543 Original CRISPR TCCTGTCACTAAAGGGATCT AGG (reversed) Intergenic