ID: 1031678546

View in Genome Browser
Species Human (GRCh38)
Location 7:124641646-124641668
Sequence CACCCACTCCTGTCACTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031678546_1031678550 7 Left 1031678546 7:124641646-124641668 CCCTTTAGTGACAGGAGTGGGTG No data
Right 1031678550 7:124641676-124641698 AGACTGTGGAGCTAGACTGCAGG No data
1031678546_1031678548 -7 Left 1031678546 7:124641646-124641668 CCCTTTAGTGACAGGAGTGGGTG No data
Right 1031678548 7:124641662-124641684 GTGGGTGAGAGCCTAGACTGTGG No data
1031678546_1031678551 8 Left 1031678546 7:124641646-124641668 CCCTTTAGTGACAGGAGTGGGTG No data
Right 1031678551 7:124641677-124641699 GACTGTGGAGCTAGACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031678546 Original CRISPR CACCCACTCCTGTCACTAAA GGG (reversed) Intergenic