ID: 1031678551

View in Genome Browser
Species Human (GRCh38)
Location 7:124641677-124641699
Sequence GACTGTGGAGCTAGACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031678547_1031678551 7 Left 1031678547 7:124641647-124641669 CCTTTAGTGACAGGAGTGGGTGA No data
Right 1031678551 7:124641677-124641699 GACTGTGGAGCTAGACTGCAGGG No data
1031678543_1031678551 15 Left 1031678543 7:124641639-124641661 CCTAGATCCCTTTAGTGACAGGA No data
Right 1031678551 7:124641677-124641699 GACTGTGGAGCTAGACTGCAGGG No data
1031678546_1031678551 8 Left 1031678546 7:124641646-124641668 CCCTTTAGTGACAGGAGTGGGTG No data
Right 1031678551 7:124641677-124641699 GACTGTGGAGCTAGACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031678551 Original CRISPR GACTGTGGAGCTAGACTGCA GGG Intergenic