ID: 1031682501

View in Genome Browser
Species Human (GRCh38)
Location 7:124691831-124691853
Sequence TGACATTGTTGGTTTCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031682501_1031682505 27 Left 1031682501 7:124691831-124691853 CCCTCAAGAAACCAACAATGTCA No data
Right 1031682505 7:124691881-124691903 GTCTTGTAATAGTGTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031682501 Original CRISPR TGACATTGTTGGTTTCTTGA GGG (reversed) Intergenic
No off target data available for this crispr