ID: 1031682605

View in Genome Browser
Species Human (GRCh38)
Location 7:124692803-124692825
Sequence CTTACCAAGAGGAATTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031682596_1031682605 21 Left 1031682596 7:124692759-124692781 CCAACAGATTTTCTAATTGAGTG No data
Right 1031682605 7:124692803-124692825 CTTACCAAGAGGAATTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031682605 Original CRISPR CTTACCAAGAGGAATTTGGA TGG Intergenic
No off target data available for this crispr