ID: 1031688927

View in Genome Browser
Species Human (GRCh38)
Location 7:124765079-124765101
Sequence GTTCCCCGCTACCCGGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031688927_1031688936 -2 Left 1031688927 7:124765079-124765101 CCCCCGCCCGGGTAGCGGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 125
Right 1031688936 7:124765100-124765122 ACCGGAGATTAGGGTGATAGCGG 0: 1
1: 0
2: 0
3: 5
4: 98
1031688927_1031688939 12 Left 1031688927 7:124765079-124765101 CCCCCGCCCGGGTAGCGGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 125
Right 1031688939 7:124765114-124765136 TGATAGCGGAAGATCGGTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 18
1031688927_1031688938 6 Left 1031688927 7:124765079-124765101 CCCCCGCCCGGGTAGCGGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 125
Right 1031688938 7:124765108-124765130 TTAGGGTGATAGCGGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 76
1031688927_1031688940 13 Left 1031688927 7:124765079-124765101 CCCCCGCCCGGGTAGCGGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 125
Right 1031688940 7:124765115-124765137 GATAGCGGAAGATCGGTCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 35
1031688927_1031688942 15 Left 1031688927 7:124765079-124765101 CCCCCGCCCGGGTAGCGGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 125
Right 1031688942 7:124765117-124765139 TAGCGGAAGATCGGTCTTGGGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1031688927_1031688941 14 Left 1031688927 7:124765079-124765101 CCCCCGCCCGGGTAGCGGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 125
Right 1031688941 7:124765116-124765138 ATAGCGGAAGATCGGTCTTGGGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031688927 Original CRISPR GTTCCCCGCTACCCGGGCGG GGG (reversed) Exonic