ID: 1031690557

View in Genome Browser
Species Human (GRCh38)
Location 7:124782655-124782677
Sequence GCATCAGCACTTCTTTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031690557_1031690569 25 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690569 7:124782703-124782725 CTGTCTGTGGAGGGGCCCGTGGG No data
1031690557_1031690564 12 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690564 7:124782690-124782712 AAGGGATGTAGGGCTGTCTGTGG No data
1031690557_1031690562 1 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690562 7:124782679-124782701 CACAAGGATGCAAGGGATGTAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1031690557_1031690560 -7 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690560 7:124782671-124782693 CTGATGCACACAAGGATGCAAGG No data
1031690557_1031690568 24 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690568 7:124782702-124782724 GCTGTCTGTGGAGGGGCCCGTGG 0: 1
1: 0
2: 7
3: 37
4: 289
1031690557_1031690565 15 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690565 7:124782693-124782715 GGATGTAGGGCTGTCTGTGGAGG No data
1031690557_1031690566 16 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690566 7:124782694-124782716 GATGTAGGGCTGTCTGTGGAGGG No data
1031690557_1031690563 2 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690563 7:124782680-124782702 ACAAGGATGCAAGGGATGTAGGG 0: 1
1: 0
2: 0
3: 20
4: 237
1031690557_1031690567 17 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690567 7:124782695-124782717 ATGTAGGGCTGTCTGTGGAGGGG 0: 1
1: 0
2: 0
3: 22
4: 222
1031690557_1031690561 -6 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690561 7:124782672-124782694 TGATGCACACAAGGATGCAAGGG 0: 1
1: 0
2: 2
3: 13
4: 165
1031690557_1031690570 26 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690570 7:124782704-124782726 TGTCTGTGGAGGGGCCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031690557 Original CRISPR GCATCAGCACTTCTTTGGCA AGG (reversed) Intronic
900789432 1:4669934-4669956 GCATCAACACTTCTTGGACACGG + Intronic
906345210 1:45010565-45010587 GCAGCAGCAGCTCTTTGGCGTGG - Exonic
907847709 1:58224376-58224398 GGAACAGCACTTTTTTGGCAGGG + Intronic
910024403 1:82631490-82631512 GTATCAGTATTTCTTTGGGAGGG - Intergenic
910380540 1:86622265-86622287 GCCACACCAATTCTTTGGCATGG + Intergenic
915405660 1:155657928-155657950 GTGCCAGCACTACTTTGGCAAGG + Intergenic
916929251 1:169557820-169557842 ATATAAGCATTTCTTTGGCATGG - Intronic
921138200 1:212281840-212281862 GGATCAGAAATTCTATGGCATGG + Intergenic
921795736 1:219342454-219342476 GCATCAGCACTTCCTTGTGCAGG - Intergenic
1064225127 10:13476313-13476335 GTATCAGAACTTCTCTGGGAGGG - Intronic
1066454709 10:35563130-35563152 GCAGCAGCACATCTTTTACAGGG - Intronic
1067821011 10:49530158-49530180 GCATCACCATTTCTTTGGCCTGG - Intronic
1072562707 10:96590888-96590910 GCATCACCACCTAATTGGCAAGG - Intergenic
1074170958 10:110936548-110936570 GCATCAGCTTTTCTTAGGAAAGG + Intronic
1074602118 10:114925308-114925330 GCCCCAGAACTTCTTTAGCATGG + Intergenic
1076288971 10:129329597-129329619 GGACCAGCAGTTCTTTGCCACGG - Intergenic
1076537847 10:131194125-131194147 GCATTCCCACTGCTTTGGCACGG - Intronic
1079650239 11:22919543-22919565 GCCACACCAATTCTTTGGCATGG - Intergenic
1082139087 11:48585756-48585778 GCCTCAGGGCTTCTTGGGCACGG + Intergenic
1082140728 11:48605421-48605443 GCCTCAGGACTTCTTGGGCATGG + Intergenic
1082567895 11:54702190-54702212 GCCTCAGGACTTCTTGGGCATGG + Intergenic
1082618529 11:55393023-55393045 GCCTCAGGGCTTCTTGGGCACGG + Intergenic
1082621302 11:55425624-55425646 GCCTCAGGACTTCTTGGGCATGG + Intergenic
1083900772 11:65642251-65642273 ACATCAGAACTTCTTCGGGATGG + Exonic
1084554440 11:69867549-69867571 CCATCAGCATTTCCATGGCAGGG + Intergenic
1085936038 11:81144501-81144523 CCATCTGCTCTTCTTTGACATGG - Intergenic
1100566903 12:95804728-95804750 GTATCAACACTGATTTGGCATGG - Intronic
1103605120 12:122080184-122080206 GCAACAGAACTTCTTTGGACTGG + Intronic
1107722751 13:43266456-43266478 GCAAAACCCCTTCTTTGGCATGG - Intronic
1108278621 13:48838616-48838638 TCTTCAGCACCTCTTTTGCAGGG - Intergenic
1108633215 13:52307347-52307369 GTATTACCACTTCTTTTGCAAGG - Intergenic
1108653475 13:52505215-52505237 GTATTACCACTTCTTTTGCAAGG + Intergenic
1123925629 15:25107510-25107532 AGATCAGCATTTCTTTGGGATGG - Intergenic
1131422616 15:92319872-92319894 GCTGCAGCCCTTCTTTGGCAGGG - Intergenic
1132618910 16:855259-855281 GCATCTGCACGTCTCAGGCAGGG - Intronic
1136054812 16:27680430-27680452 GCATCAGCTGTTCTGTGGCCTGG - Intronic
1138308676 16:56004350-56004372 CCATCACCACTTCTTTGCAATGG + Intergenic
1141280099 16:82623590-82623612 GCATCAGCCTAGCTTTGGCACGG - Intergenic
1141285288 16:82666315-82666337 GTAACAGCACTGCTTTGGTAAGG + Intronic
1141816842 16:86416457-86416479 GGATCAGCACTTCATTTGTATGG - Intergenic
1142996596 17:3764190-3764212 GTATCACCCCTTCTTTGTCAGGG - Intronic
1147615314 17:41823874-41823896 CCATCAGCACTTCTTGCCCAGGG + Intergenic
1147816300 17:43213180-43213202 GCATCAGCAGTTCCTTCACAAGG - Exonic
1151035991 17:70800549-70800571 GCAGTAGCACTTATTTGGGAGGG - Intergenic
1151132762 17:71915266-71915288 GCATGTTCACTTCTTAGGCAGGG - Intergenic
1153819860 18:8824047-8824069 GCAACAGAACCTCTTTGGCCTGG - Intronic
1153917077 18:9755588-9755610 GCTTCAGCTCTTCTTGGGCTGGG + Intronic
1156490883 18:37495320-37495342 GCATCTTCACTTGTTTGGGAGGG + Intronic
1166242856 19:41505759-41505781 GCATACGCCCTTCTGTGGCAAGG - Intergenic
925887129 2:8402522-8402544 GCATCAGCAGGTTTTTGGAATGG + Intergenic
931654503 2:64498728-64498750 GGGTCAGAACTTCTTTGGGAAGG + Intergenic
932844410 2:75120533-75120555 GCACCATCGTTTCTTTGGCATGG + Intronic
937996427 2:127698034-127698056 GCATCTGCACATCCTGGGCAGGG - Intergenic
940631610 2:156246806-156246828 GCCTCAGCTTTTCTTTGGTAGGG - Intergenic
944126885 2:196304206-196304228 GTCTCTGCACTTCCTTGGCAAGG + Intronic
944436598 2:199696390-199696412 GCAACAACACTTCAATGGCAGGG - Intergenic
947545604 2:231008278-231008300 GCATCTGCACTTCTTTGCCTGGG - Intronic
947615686 2:231555391-231555413 GCCTCAGGACTTCTTTGACGTGG - Intergenic
947779043 2:232740568-232740590 GAATTAGCTCTTCTTGGGCAAGG - Intronic
948909413 2:240995564-240995586 GGATCAGCGCTTCTGGGGCAGGG + Intergenic
1174856346 20:54049015-54049037 GCAACAGCACTTGTCTGGAAGGG - Intronic
1177809113 21:25905826-25905848 GCATCAGAAGTGCTTTGGAAAGG - Intronic
1179397270 21:41052663-41052685 GGATGAACACTTCTTTTGCAAGG + Intergenic
1183366221 22:37408446-37408468 TTAACAGCACTTCCTTGGCAGGG - Intronic
1183933259 22:41248137-41248159 GCAACAGCACTGCTATGGAAAGG + Intronic
956801472 3:72763498-72763520 ACATCAACACATCTTTGTCAGGG - Intronic
957916828 3:86696346-86696368 GCCACACCAATTCTTTGGCATGG - Intergenic
958448382 3:94242851-94242873 GAATCAGTAGTTCTGTGGCAGGG + Intergenic
961125865 3:124416892-124416914 GCATAAGCCCTTATTTAGCATGG - Intronic
961993851 3:131220027-131220049 GTATCATCACTTCTGTTGCAAGG + Intronic
965941837 3:174193656-174193678 CCATCTGCACTACTTTGCCATGG - Intronic
967488800 3:190065033-190065055 GCATAAGCAGTTTTTAGGCAGGG - Intronic
975087286 4:70357110-70357132 GCATCAGGACTTCTTTGCTGAGG + Intergenic
977568139 4:98602693-98602715 GCATGAGCAATTCTGTCGCAGGG - Intronic
979381278 4:120009623-120009645 TCTTCAGCATTTCTTTGGTAGGG - Intergenic
980392380 4:132163319-132163341 GCCACACCAATTCTTTGGCATGG + Intergenic
982135698 4:152272299-152272321 CCCTCAGCACTTCTCTGACAGGG - Intergenic
984197145 4:176671923-176671945 GCAACAGCACTTCTTTTAAAAGG + Intergenic
987987257 5:25163199-25163221 GCCACATCAATTCTTTGGCATGG + Intergenic
998614935 5:143729575-143729597 GCATTACAACTTCATTGGCAGGG - Intergenic
1000097830 5:157986713-157986735 GCATCTGCACGTCTTTCACATGG + Intergenic
1002144849 5:177171779-177171801 GTATCAGGACTTCTTTTTCATGG + Intronic
1002506181 5:179680687-179680709 GAATCAGCACTTACTGGGCAGGG - Intronic
1002822907 6:744783-744805 ACATAAGCACTTCTTTTGCTCGG - Intergenic
1007237585 6:40401881-40401903 GCCTCAGCACTAATTTGGAAGGG + Intronic
1007815384 6:44520943-44520965 GCCTCAGCACTTGTCTGGGAAGG + Intergenic
1010262103 6:73829409-73829431 GCATCATCACTTAGATGGCATGG - Intergenic
1010905360 6:81480117-81480139 GTCTCAGCATTTCTTGGGCAGGG + Intergenic
1015811358 6:137164732-137164754 GCATCTGCATTGCTTGGGCACGG - Intronic
1021350090 7:19581706-19581728 TCATTAGCACTTCTCTGGCAGGG - Intergenic
1023142219 7:37113018-37113040 GCATCAGCATATCTGGGGCAAGG + Intronic
1024235248 7:47392760-47392782 TCCTCAGCCCCTCTTTGGCATGG - Intronic
1026330755 7:69350569-69350591 ACAGCAGCACATCCTTGGCAGGG - Intergenic
1026387452 7:69864340-69864362 GCATCATCTCTTCTCTAGCATGG - Intronic
1031690557 7:124782655-124782677 GCATCAGCACTTCTTTGGCAAGG - Intronic
1031937885 7:127754623-127754645 CCATCAGCACTTCCCTGGCCTGG - Intronic
1031978996 7:128112363-128112385 ACATCAGCACTCCCTGGGCATGG + Intergenic
1032926971 7:136617973-136617995 TCATCACCACTTCTTGGCCAGGG - Intergenic
1035681408 8:1491267-1491289 GCATCGGCAGTTCCTGGGCAGGG - Intergenic
1036699409 8:11002106-11002128 GCATTTGCACTTTCTTGGCAGGG - Intronic
1040110356 8:43564460-43564482 GCATCACCACTTTTTTTCCATGG + Intergenic
1041138735 8:54790050-54790072 GCAGCAGCACTTCTTGGCCAGGG + Intergenic
1042274550 8:66990115-66990137 CCAACAGCATTTGTTTGGCAGGG + Intronic
1044359863 8:91270467-91270489 GCACCAGCACTTAATTGCCAGGG + Intronic
1053248378 9:36553992-36554014 GATTCAGCAGGTCTTTGGCAGGG + Intergenic
1059871541 9:118583782-118583804 GAATCTACTCTTCTTTGGCAAGG + Intergenic
1185683490 X:1908241-1908263 GCATCAGGATTTCTTTAGAAAGG + Intergenic
1186523111 X:10223050-10223072 GGATCAGTACCTCTGTGGCAGGG - Intronic
1194520575 X:94914247-94914269 GGATCAGCAATTCTCTGGCTAGG - Intergenic
1197249225 X:124197409-124197431 GCCTGATCACTTCTTTGGCTTGG + Intronic
1197675534 X:129325974-129325996 GCATCAGCTCTTCCTTGTCTTGG - Intergenic
1197806440 X:130402548-130402570 TCATGAGCACTGATTTGGCAGGG - Intronic
1201982085 Y:19918847-19918869 ACCACATCACTTCTTTGGCATGG - Intergenic