ID: 1031690558

View in Genome Browser
Species Human (GRCh38)
Location 7:124782660-124782682
Sequence TGTGTGCATCAGCACTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 165}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031690558_1031690564 7 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690564 7:124782690-124782712 AAGGGATGTAGGGCTGTCTGTGG No data
1031690558_1031690567 12 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690567 7:124782695-124782717 ATGTAGGGCTGTCTGTGGAGGGG 0: 1
1: 0
2: 0
3: 22
4: 222
1031690558_1031690565 10 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690565 7:124782693-124782715 GGATGTAGGGCTGTCTGTGGAGG No data
1031690558_1031690562 -4 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690562 7:124782679-124782701 CACAAGGATGCAAGGGATGTAGG 0: 1
1: 0
2: 2
3: 15
4: 213
1031690558_1031690570 21 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690570 7:124782704-124782726 TGTCTGTGGAGGGGCCCGTGGGG No data
1031690558_1031690569 20 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690569 7:124782703-124782725 CTGTCTGTGGAGGGGCCCGTGGG No data
1031690558_1031690568 19 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690568 7:124782702-124782724 GCTGTCTGTGGAGGGGCCCGTGG 0: 1
1: 0
2: 7
3: 37
4: 289
1031690558_1031690563 -3 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690563 7:124782680-124782702 ACAAGGATGCAAGGGATGTAGGG 0: 1
1: 0
2: 0
3: 20
4: 237
1031690558_1031690566 11 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690566 7:124782694-124782716 GATGTAGGGCTGTCTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031690558 Original CRISPR TGTGTGCATCAGCACTTCTT TGG (reversed) Intronic
907500511 1:54876095-54876117 TGTGTGCAGCAGCTCCCCTTGGG - Intronic
909125079 1:71657331-71657353 TCTGTGAAACATCACTTCTTTGG + Intronic
909473775 1:76059093-76059115 AGTGTGTACCAGCACATCTTTGG + Intergenic
910268211 1:85363757-85363779 TTTGTTAATCAGCACATCTTTGG + Intronic
911785342 1:101939239-101939261 TGTTTGCTTAAGCACTTCTTTGG + Intronic
911992377 1:104717005-104717027 TGTGAGCATGTGCACTTTTTTGG - Intergenic
913960010 1:143332168-143332190 TTTGTGTAACAGCAATTCTTGGG + Intergenic
914054365 1:144157741-144157763 TTTGTGTAACAGCAATTCTTGGG + Intergenic
914124781 1:144808620-144808642 TTTGTGTAACAGCAATTCTTGGG - Intergenic
914836212 1:151209068-151209090 TGTGTTCAGCAGTACTTCTCAGG + Intronic
919320745 1:196034069-196034091 GGTTTGTATCAGCACCTCTTTGG - Intergenic
921363675 1:214353822-214353844 TGTGTTCATTAGCACTGCTCTGG + Exonic
921823273 1:219641472-219641494 TGTTTGTACCAGCCCTTCTTGGG - Intergenic
922033279 1:221824955-221824977 TGTCAGCCTCAGAACTTCTTGGG - Intergenic
1063111711 10:3043947-3043969 TGTGTGATTCAGCATTTCTTGGG + Intergenic
1063812132 10:9723244-9723266 TCTGTGCTGGAGCACTTCTTGGG + Intergenic
1064225032 10:13475027-13475049 AGTGTGCATCAGAATTTCCTGGG - Intronic
1064306209 10:14169137-14169159 TGTCTGCATCAGCTCCTCCTGGG + Intronic
1065734654 10:28740714-28740736 TGTGTTCATCAGTCCTGCTTCGG - Intergenic
1066984701 10:42454632-42454654 TGTGTGTCTCAGCGCTTGTTGGG - Intergenic
1067370593 10:45678531-45678553 TGTGTCTCTCAGCACTTGTTGGG + Intergenic
1067389188 10:45847625-45847647 TGTGTCTCTCAGCACTTGTTGGG - Intronic
1067503654 10:46830275-46830297 ATTGTGCATGAGCACCTCTTGGG + Intergenic
1068684152 10:59852304-59852326 TGTGCTCATCAGCAATTTTTTGG + Intronic
1069944587 10:71977166-71977188 TGTGGGCAGCAACACTTTTTGGG - Intronic
1070805114 10:79266363-79266385 TGTTTGAATCACCCCTTCTTGGG + Intronic
1073640318 10:105245877-105245899 TGTCTGCCTCAGAACTTGTTTGG + Intronic
1074170957 10:110936543-110936565 AGTCTGCATCAGCTTTTCTTAGG + Intronic
1074703643 10:116112933-116112955 TGTGTGCACCAGCGCTCCTGAGG - Intronic
1074934120 10:118160512-118160534 TGTGTGCATCCGAACTCCTATGG + Intergenic
1075342492 10:121658670-121658692 TGTGAACATCAGCACTTGTAGGG - Intergenic
1076217054 10:128703590-128703612 TGCCTGCTTCAGCACCTCTTTGG + Intergenic
1081276389 11:41154728-41154750 TGTGTGACTCAACACATCTTAGG - Intronic
1082140727 11:48605416-48605438 TCTGAGCCTCAGGACTTCTTGGG + Intergenic
1082307063 11:50592183-50592205 TGTGTGCATTTGGATTTCTTTGG + Intergenic
1082567894 11:54702185-54702207 TCTGAGCCTCAGGACTTCTTGGG + Intergenic
1082621301 11:55425619-55425641 TCTGAGCCTCAGGACTTCTTGGG + Intergenic
1082940908 11:58704055-58704077 TGTATGCACCAGCACTGCTGAGG - Intronic
1083809368 11:65095052-65095074 AGTGTGTATCAGAACTACTTGGG + Intronic
1088442542 11:109887790-109887812 TGTTGGCATCTGCCCTTCTTTGG + Intergenic
1088944345 11:114494824-114494846 TGTGTGCACCTGTCCTTCTTGGG + Intergenic
1089034355 11:115370532-115370554 TGTTTGCATGACCTCTTCTTTGG - Intronic
1090056506 11:123429389-123429411 AGTGTGGTTCAGCACATCTTGGG + Intergenic
1091456235 12:610175-610197 TGTGTGCATGTGCACTTGTCAGG - Intronic
1091704813 12:2686479-2686501 CCTGTGCACCAGCACTTCCTAGG - Intronic
1092839128 12:12522143-12522165 TGTGAGCTTCAGCACTTCACAGG - Intronic
1093007313 12:14064523-14064545 TGGGTAAATCAGCCCTTCTTAGG - Intergenic
1094317249 12:29148385-29148407 TGTGCTCAGCAGCACTTCTCCGG - Intergenic
1095998666 12:48111197-48111219 TGGGTGAAGCAGCACTCCTTTGG - Intronic
1097639260 12:62159938-62159960 TGCGTGTTTCTGCACTTCTTGGG + Intronic
1097695282 12:62769232-62769254 TTTGTGGATCAGAGCTTCTTAGG - Intronic
1098267161 12:68733591-68733613 TTTGTGCATCAGAGCTTATTTGG + Exonic
1099099074 12:78414164-78414186 TGTGTACATATGCATTTCTTTGG + Intergenic
1099367045 12:81779897-81779919 TGTGTACATCACCATTTGTTTGG + Intergenic
1103605119 12:122080179-122080201 TCTGCGCAACAGAACTTCTTTGG + Intronic
1104739730 12:131163885-131163907 TGTGTGGATGAGGACTCCTTGGG + Intergenic
1104908584 12:132228609-132228631 TGTGAGCATCAGAACGTCTGGGG - Intronic
1111017171 13:82396772-82396794 TTTGTGCATCAGGACTGCTTTGG + Intergenic
1113273851 13:108706620-108706642 TCTGTACATCTGCACCTCTTGGG + Intronic
1113478711 13:110604719-110604741 TGTGTTCATTAGCAGTTCCTGGG + Intergenic
1114406848 14:22464791-22464813 TGTGTGGATCAGCCTGTCTTTGG + Intergenic
1116734159 14:48667852-48667874 TGAGTGCCTGAGCAATTCTTAGG + Intergenic
1120054924 14:79912803-79912825 TGTGTACATCAGGACATCTAGGG + Intergenic
1120810395 14:88797681-88797703 TGTGTTAGTCAGGACTTCTTTGG + Intergenic
1124716353 15:32066030-32066052 TGTGTGCTGGAGCACATCTTCGG - Intronic
1125450367 15:39801213-39801235 TGTCTGGATCAGCTCTTCTGGGG + Exonic
1125523654 15:40362047-40362069 TGTGTGCAGCCCCACTCCTTGGG - Intronic
1126041498 15:44595411-44595433 TGTTTGGATCATCACTTCTGTGG - Exonic
1126540485 15:49817079-49817101 TGTGTGCATTAGAATTACTTGGG + Intergenic
1128450601 15:67803989-67804011 TGTGTGAGTTAACACTTCTTTGG + Intronic
1131329855 15:91486899-91486921 GGTGTGCATCAGAATTACTTGGG + Intergenic
1133911381 16:10069540-10069562 TGTGTGCAGCTGCACTGCCTGGG - Intronic
1137479737 16:48842217-48842239 TGTGGGCATCAGTATTTTTTAGG - Intergenic
1137521831 16:49201502-49201524 TGTGAGCCTCTGCAATTCTTGGG - Intergenic
1138954719 16:61957175-61957197 TGTGTGTATCTGCATGTCTTAGG - Intronic
1139009560 16:62615597-62615619 TGTGAGCTTGAGAACTTCTTGGG - Intergenic
1139402594 16:66695023-66695045 TGAGTGCATAAGCATTCCTTGGG - Intronic
1140605517 16:76532192-76532214 TGTATGCATCAGCTCATCTTTGG - Intronic
1140889918 16:79276302-79276324 TGTTTGCAGCAGGCCTTCTTGGG + Intergenic
1142050564 16:87955271-87955293 TGTGTCCATCAGCATCACTTGGG + Intronic
1142604213 17:1072737-1072759 TGTGTGCTTCAGCAGGTCCTGGG + Exonic
1142607742 17:1091370-1091392 TGTGTGGATGGGCACTTCTGTGG - Intronic
1143759360 17:9089967-9089989 TGTGGGCTTCAGGACTTCTGGGG - Intronic
1146240624 17:31219639-31219661 TGTGTGAATAAGAACTACTTAGG - Intronic
1152650408 17:81489976-81489998 TGTGTGAATTTGCATTTCTTTGG - Intergenic
1152882757 17:82829187-82829209 TGTGTGCATGTGCACGTCTGCGG - Intronic
1153917075 18:9755583-9755605 TTTGAGCTTCAGCTCTTCTTGGG + Intronic
1159122831 18:64190545-64190567 TGTGGCCATTATCACTTCTTTGG + Intergenic
1164478200 19:28591390-28591412 TGTGTGCATCTGGACTCGTTAGG + Intergenic
1165466483 19:35977876-35977898 TGTGTGCATGGCCACTACTTTGG + Intergenic
1168304651 19:55428996-55429018 TGTGTGCATTTGCATTTGTTGGG + Exonic
1168394452 19:56036512-56036534 TTTGTTCATCAGCACATCTCTGG - Intronic
1202693844 1_KI270712v1_random:110419-110441 TTTGTGTAACAGCAATTCTTGGG + Intergenic
927098135 2:19763714-19763736 TGTCTGTATCTGAACTTCTTGGG - Intergenic
929939524 2:46322439-46322461 AGTGTGCATCAGAACTGCCTGGG + Intronic
932516235 2:72353013-72353035 TGAATGCATCAGAAATTCTTGGG + Intronic
933024015 2:77231191-77231213 TGTGTGCATGTGTACTTCATGGG - Intronic
933952718 2:87344156-87344178 TTTGTGTAACAGCAATTCTTGGG - Intergenic
934236960 2:90240502-90240524 TTTGTGTAACAGCAATTCTTGGG - Intergenic
941590053 2:167408777-167408799 TGTATACATCTTCACTTCTTTGG - Intergenic
944475326 2:200098032-200098054 TGTGTGCATCAGTAATTTCTAGG + Intergenic
944874333 2:203946359-203946381 TGTGTTCATGAGCACTCTTTTGG + Intronic
946346268 2:219113315-219113337 TTTGTGCTTCAGCACGTATTTGG - Intronic
948059841 2:235034609-235034631 TGTTTGCACCTGCTCTTCTTAGG - Intronic
1169538755 20:6577079-6577101 TTTGTGCATCAGAATTCCTTGGG - Intergenic
1170990132 20:21293567-21293589 TGTGTGAATCAGTAGTTTTTTGG - Intergenic
1173233015 20:41216824-41216846 TGAGTGCATCCTCAGTTCTTTGG - Intronic
1174572957 20:51515894-51515916 AGTGTGCATCAGAACCTCTAGGG - Intronic
1174803219 20:53582530-53582552 TCTGTGAACCAGCAGTTCTTCGG - Exonic
1182000187 22:26913715-26913737 TCTGTGCATCAGCATTACTGGGG + Intergenic
1184097710 22:42325494-42325516 CGTGTGCATGAGTACTGCTTGGG - Intronic
950368480 3:12506842-12506864 TGTGTTCCATAGCACTTCTTGGG - Intronic
953090863 3:39724817-39724839 TGTGTGGTTCAACTCTTCTTTGG - Intergenic
953795321 3:45980929-45980951 TTTTTACATCAGCACTTTTTGGG + Intronic
954302266 3:49706270-49706292 GGTGTGCTTCAGCACTTATTGGG - Intronic
956323163 3:68021406-68021428 AGTGTGTATCCACACTTCTTGGG + Intronic
957303307 3:78421462-78421484 TGTGTGCAGCAGCACTCATGAGG + Intergenic
958622770 3:96583076-96583098 TCTGGGCAGCAGGACTTCTTAGG + Intergenic
959430098 3:106243133-106243155 TGCATTCATCAGCACTTTTTTGG - Intergenic
962234085 3:133693089-133693111 TGTGTGCACCAGCAACTCCTGGG + Intergenic
963715562 3:148799381-148799403 TGTGAAAATCAGCACTTCTCAGG - Intronic
964697446 3:159525466-159525488 TGTGTGCTTCAGCACCTCAAGGG - Intronic
967795589 3:193595241-193595263 TGAGAGCATAAGCATTTCTTTGG + Intronic
967961717 3:194930862-194930884 TGTGTGCCTCAAGACTTCATGGG - Intergenic
968286256 3:197510491-197510513 GGTCTGCATGATCACTTCTTGGG - Exonic
968607797 4:1543702-1543724 TGCCTGCCTCAGCTCTTCTTGGG - Intergenic
974274438 4:59699549-59699571 TGGCAGCATCAACACTTCTTGGG + Intergenic
974616372 4:64288229-64288251 TGTGTTCATTAGCGGTTCTTGGG - Intronic
982865705 4:160508438-160508460 TGTCTGGATCAGCACTTCCTTGG + Intergenic
985871644 5:2562219-2562241 TGTGTGCATCGGCACTTTCCCGG + Intergenic
991403226 5:66276025-66276047 TGTGTTCATATGCACTTCTCTGG + Intergenic
993042292 5:82828094-82828116 AGTTTGCATTGGCACTTCTTGGG + Intergenic
995609887 5:113898126-113898148 TGTATCCAGCAGAACTTCTTTGG + Intergenic
996702476 5:126464378-126464400 TTTATGGATCAGAACTTCTTTGG - Intronic
997336705 5:133113777-133113799 TGTGTGGAGCAGCTCTTCTCCGG + Intergenic
998253776 5:140569640-140569662 TGTGTGCATCAGAACCACCTAGG - Intronic
1000759707 5:165207173-165207195 TGTATGCTTGAGCACTTCATTGG + Intergenic
1001460667 5:171910457-171910479 TGTGTGAGGCAGCATTTCTTTGG - Intronic
1002783563 6:384605-384627 TGTGTGTTTCAGCATCTCTTGGG - Intergenic
1003721020 6:8702166-8702188 TGTGTCCATCAGCATGTCTGAGG + Intergenic
1005053752 6:21710462-21710484 TGTGTGATTCACAACTTCTTGGG + Intergenic
1007519100 6:42437876-42437898 GGTGTGCATCTGCACTTAGTAGG + Intronic
1010568351 6:77446453-77446475 TCTGTGCTTTAGCATTTCTTGGG + Intergenic
1015619411 6:135114867-135114889 TGTGTGGCTCATCATTTCTTCGG + Intergenic
1015782164 6:136879875-136879897 TGTGTGAATCTGCTCTTCTTGGG + Intronic
1020426459 7:8071712-8071734 TGTGTACACCAACACTTCCTGGG + Intronic
1021415356 7:20377411-20377433 TGTGTGGATCAGCGTTTTTTTGG - Intronic
1022195032 7:28056739-28056761 TGTGTGCATCAGGAATTGTTAGG - Intronic
1023336944 7:39180429-39180451 TGTGTCCCCCACCACTTCTTGGG + Intronic
1029757919 7:102584528-102584550 TGTGGGCAGCAGCTCCTCTTGGG + Intronic
1031690558 7:124782660-124782682 TGTGTGCATCAGCACTTCTTTGG - Intronic
1041454649 8:58045223-58045245 TGTGTGCATCAGCAGTCATCAGG + Intronic
1041491957 8:58443036-58443058 TGTGTGACTCAGTACTTCTGGGG + Intronic
1043928339 8:86062957-86062979 TGTGTTCATTTGCATTTCTTTGG + Intronic
1045861412 8:106818529-106818551 TGTGTATATCAGCATATCTTTGG + Intergenic
1049956201 9:695451-695473 TGTGTGCACACGCACTGCTTGGG - Intronic
1050263186 9:3862642-3862664 TGTGTGTTTTAGCACTGCTTTGG + Intronic
1050687133 9:8184406-8184428 TTTGTGCAGCATCTCTTCTTCGG + Intergenic
1051950778 9:22629599-22629621 TGTGAGCATCAGCATTTCCCTGG - Intergenic
1053735336 9:41097944-41097966 TGTGAGCAACAGGATTTCTTGGG - Intergenic
1055019943 9:71658989-71659011 TGTGTACTTCAGCTCATCTTAGG + Intergenic
1055772451 9:79731825-79731847 TTTGTGCATGAGCAAATCTTTGG - Intergenic
1056481657 9:87012380-87012402 TGTGGGCATCAGCAGTGCTGAGG + Intergenic
1061621326 9:131813065-131813087 TGTGTGCCTCAACTCTTCTGTGG - Intergenic
1186179258 X:6957120-6957142 TGCATGCATCAGCAGTTATTTGG - Intergenic
1188362031 X:29266821-29266843 TGTGGTCATCACAACTTCTTTGG + Intronic
1192957358 X:76086850-76086872 TGTGTTCATTAGCAATTCCTGGG - Intergenic
1194184502 X:90757261-90757283 TGTGTGCAGAACCACTTATTTGG - Intergenic
1194218735 X:91166325-91166347 TGTTTGTATCTGCCCTTCTTGGG + Intergenic
1196037049 X:111157109-111157131 AGTGTGCATCAGAATTTCATGGG + Intronic
1196532601 X:116806468-116806490 GGTGAGCACAAGCACTTCTTTGG + Intergenic
1200531097 Y:4339204-4339226 TGTGTGCAGAACCACTTATTTGG - Intergenic
1200555245 Y:4630077-4630099 TGTTTGTATCTGCCCTTCTTGGG + Intergenic
1200595015 Y:5129086-5129108 TGTGTGCATTAGCACATTATTGG - Intronic