ID: 1031690569

View in Genome Browser
Species Human (GRCh38)
Location 7:124782703-124782725
Sequence CTGTCTGTGGAGGGGCCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031690557_1031690569 25 Left 1031690557 7:124782655-124782677 CCTTGCCAAAGAAGTGCTGATGC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1031690569 7:124782703-124782725 CTGTCTGTGGAGGGGCCCGTGGG No data
1031690558_1031690569 20 Left 1031690558 7:124782660-124782682 CCAAAGAAGTGCTGATGCACACA 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1031690569 7:124782703-124782725 CTGTCTGTGGAGGGGCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031690569 Original CRISPR CTGTCTGTGGAGGGGCCCGT GGG Intronic
No off target data available for this crispr