ID: 1031692776

View in Genome Browser
Species Human (GRCh38)
Location 7:124811094-124811116
Sequence TAGATCACATGTTAGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031692775_1031692776 -5 Left 1031692775 7:124811076-124811098 CCTTAAGAATAGTCAAACTAGAT No data
Right 1031692776 7:124811094-124811116 TAGATCACATGTTAGATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031692776 Original CRISPR TAGATCACATGTTAGATGAA AGG Intergenic
No off target data available for this crispr