ID: 1031695310

View in Genome Browser
Species Human (GRCh38)
Location 7:124844448-124844470
Sequence GCCACCGCGCCCGGTGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 2, 2: 13, 3: 101, 4: 496}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031695310_1031695319 16 Left 1031695310 7:124844448-124844470 CCATTGGCACCGGGCGCGGTGGC 0: 1
1: 2
2: 13
3: 101
4: 496
Right 1031695319 7:124844487-124844509 AGCACTTTGGGAGGCCGAGGCGG 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
1031695310_1031695320 17 Left 1031695310 7:124844448-124844470 CCATTGGCACCGGGCGCGGTGGC 0: 1
1: 2
2: 13
3: 101
4: 496
Right 1031695320 7:124844488-124844510 GCACTTTGGGAGGCCGAGGCGGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
1031695310_1031695312 3 Left 1031695310 7:124844448-124844470 CCATTGGCACCGGGCGCGGTGGC 0: 1
1: 2
2: 13
3: 101
4: 496
Right 1031695312 7:124844474-124844496 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1031695310_1031695313 4 Left 1031695310 7:124844448-124844470 CCATTGGCACCGGGCGCGGTGGC 0: 1
1: 2
2: 13
3: 101
4: 496
Right 1031695313 7:124844475-124844497 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1031695310_1031695317 13 Left 1031695310 7:124844448-124844470 CCATTGGCACCGGGCGCGGTGGC 0: 1
1: 2
2: 13
3: 101
4: 496
Right 1031695317 7:124844484-124844506 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
1031695310_1031695321 29 Left 1031695310 7:124844448-124844470 CCATTGGCACCGGGCGCGGTGGC 0: 1
1: 2
2: 13
3: 101
4: 496
Right 1031695321 7:124844500-124844522 GCCGAGGCGGGTAGATCACGAGG 0: 170
1: 10506
2: 47437
3: 70293
4: 63646
1031695310_1031695315 7 Left 1031695310 7:124844448-124844470 CCATTGGCACCGGGCGCGGTGGC 0: 1
1: 2
2: 13
3: 101
4: 496
Right 1031695315 7:124844478-124844500 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031695310 Original CRISPR GCCACCGCGCCCGGTGCCAA TGG (reversed) Intronic
900219546 1:1500264-1500286 GCCACCGCACCCGGCCACAAAGG - Intergenic
901094110 1:6664522-6664544 GCCACTGCGCCCGGCCTCAAGGG + Intronic
901542096 1:9925023-9925045 GCCACTGCGCCCGGTGGTAAGGG - Intronic
901877873 1:12177291-12177313 GCCACCGTGCCCGGCCCCAGTGG + Intronic
905810100 1:40906384-40906406 GCCACCGCGCCCAGCCCCATTGG + Intergenic
906171943 1:43733827-43733849 GCCACCACGCCCGGTGAAAGAGG - Intronic
908231742 1:62112217-62112239 GCCACCGCACCCGGCCCCCAAGG - Intronic
908684349 1:66698662-66698684 GCCACGGCGCCCGGCCCAAATGG + Intronic
909656627 1:78040199-78040221 GCCACCACGCCCGGCCCCCAGGG - Intronic
909864745 1:80653771-80653793 GCCACCGCGCCCGGACCACATGG + Intergenic
910320682 1:85940116-85940138 GCCACCGCGCCCGGCCCTTATGG - Intronic
910929356 1:92427669-92427691 GCCACCGCGCCCGGCCCTCATGG - Intergenic
911246207 1:95520842-95520864 GCCACCGCGCCCGGCCCATATGG - Intergenic
911461133 1:98192352-98192374 GCCACCGCGCCTGGTCTCAGTGG + Intergenic
912499166 1:110110573-110110595 GCCACCGCGCCCGGCCCCATGGG + Intergenic
914222497 1:145693480-145693502 GCCACCGCGCCCGGCACCTAGGG - Intronic
914734526 1:150402678-150402700 GCCACCGCGCCCGGCTGAAACGG - Intronic
914760832 1:150596771-150596793 GCCACCGCGCCCAGCCCAAAAGG - Intergenic
914989737 1:152488344-152488366 GCCACCGCGCCCGGCCCAAGAGG - Intergenic
915343689 1:155189204-155189226 TCCACCGCGCCCGCAGCCCACGG - Intronic
915344057 1:155190104-155190126 TCCACCGCGCCCGCAGCCCACGG - Intronic
915344078 1:155190164-155190186 TCCACCGCGCCCGCAGCCCACGG - Intronic
915344120 1:155190284-155190306 TCCACCGCGCCCGCAGCCCACGG - Intronic
915344140 1:155190344-155190366 TCCACCGCGCCCGCAGCCCACGG - Intronic
915344266 1:155190642-155190664 TCCACCGCGCCCGCAGCCCACGG - Intronic
915344456 1:155191091-155191113 TCCACCGCGCCCGCAGCCCACGG - Intronic
915344555 1:155191331-155191353 TCCACCGCGCCCGCAGCCCACGG - Intronic
915344685 1:155191692-155191714 TCCACCGCGCCCGCAGCCCACGG - Intronic
915397118 1:155593680-155593702 GCCACCGCACCCGGCCCGAATGG - Intergenic
917970048 1:180200427-180200449 GCCACCCCGGCAGGTGCCACTGG + Exonic
918058061 1:181039577-181039599 GCCACCGCGCCCGGCCTCATGGG - Intronic
918232952 1:182552398-182552420 GCCACCGCACCCTGTGCAAAAGG + Intronic
918284326 1:183037060-183037082 GCCACCGCACCTGGCCCCAAAGG + Intronic
919366320 1:196665891-196665913 GCCACCGCACCCGGCCCCAGTGG + Intronic
919952436 1:202377588-202377610 GCCACCGTGCCCGGCGAGAAGGG + Intronic
920354958 1:205365158-205365180 GCCACCGTGCCCGGCCGCAAGGG + Intergenic
920644255 1:207787356-207787378 GCCACCGCGCCCGGCCTTAATGG + Intronic
920918070 1:210274398-210274420 GCCACCACGCCCGGCCCCATTGG + Intergenic
922288954 1:224194581-224194603 GCCACCACGCCCGGTGCCATTGG - Intergenic
923008057 1:230067541-230067563 GCCTCCGCGCCGAGTGCCCAGGG + Intronic
923172956 1:231434014-231434036 GCCACCACGCCTGGCGCTAAAGG - Intergenic
923305170 1:232681858-232681880 GCCACCGCGCCCAGCCCCTAAGG - Intergenic
923310990 1:232735266-232735288 GCCACCGTGCCCGGCCCCAGAGG + Intergenic
924723544 1:246645711-246645733 GCCACCGCGCCCGGCCAAAAAGG + Intronic
1063619577 10:7633801-7633823 GCCACCGCGCCCGGCCACCACGG - Intronic
1064408983 10:15088861-15088883 GCCCCCGCGCCCGCGACCAATGG - Intergenic
1064613984 10:17133962-17133984 GCCACCGCGCCGGGCCCTAAGGG - Intergenic
1064775015 10:18766852-18766874 GCCACTGCGCCCAGCCCCAATGG - Intergenic
1064825442 10:19393739-19393761 GCCACCGCGCCCGGCCCTGATGG + Intronic
1064849587 10:19695808-19695830 GTCACCGTGCCCGGCGCCAAAGG + Intronic
1065635683 10:27730846-27730868 GCCACCGCGCCCGGCTGCCAAGG - Intronic
1067129375 10:43547704-43547726 GCCACCACGCCTGGCTCCAAAGG + Intergenic
1067499153 10:46786477-46786499 GTCACCGTGCCCGGGGCGAATGG - Intergenic
1067595488 10:47553875-47553897 GTCACCGTGCCCGGGGCGAATGG + Intergenic
1068996862 10:63216422-63216444 GCCACCGCGCCCGGCTCCTATGG - Intronic
1069030649 10:63592602-63592624 GCCACCGCGCCCGGCCCATAAGG - Intronic
1069327609 10:67250499-67250521 GCCACCGCGCCCGGCCACAGAGG + Intronic
1069563642 10:69449283-69449305 GCCACCGCGCCCGGCCAGAATGG + Intergenic
1072771693 10:98145663-98145685 GCCACCGCGCCCAGCGAGAATGG - Intronic
1073173933 10:101538759-101538781 GCCACCGCACCCGGCCCCCAGGG - Intronic
1073288977 10:102404060-102404082 GCCACCGCGCCCGGCTGGAAGGG - Intronic
1073312516 10:102553747-102553769 GCCACCGCGCCCGGCCACAAAGG + Intronic
1074220428 10:111432085-111432107 GCCACCGCGCCCGGCCACAGTGG + Intergenic
1075104367 10:119528315-119528337 GCCACCGCGCCCAGTTCCTCAGG + Intronic
1075755684 10:124809570-124809592 GCCACCACGCCTGGCCCCAAGGG + Intronic
1076551614 10:131281848-131281870 GCCACCGCGCCCGGCCAGAAGGG - Intronic
1076721680 10:132396015-132396037 ACCACCGCCCCTGGTGCCACTGG - Intergenic
1078530180 11:12131005-12131027 GCCACCGCGCCCGGCCCTACTGG - Intronic
1078972162 11:16426626-16426648 GCCACCGCGCCCGGCCAGAAGGG - Intronic
1079480825 11:20878072-20878094 GCCACCGCGCCCGGCCCAAATGG - Intronic
1080561282 11:33465338-33465360 GCCACCGTGCCCGGCCCCAGGGG + Intergenic
1080592382 11:33735629-33735651 GCCACCGCGCCCGGCCGAAACGG - Intronic
1081331048 11:41800739-41800761 GCCACCGCGCCCGGCCCACAGGG - Intergenic
1082035342 11:47641174-47641196 GCGAACGCGCCCGGCCCCAAGGG + Intronic
1082845138 11:57718939-57718961 GCCACCGCGCCCAGCCACAAAGG + Intronic
1083241250 11:61390763-61390785 GCCACCGCGCCAGGTGCAGCTGG + Intergenic
1083745838 11:64736025-64736047 GCCACAGAGCCCAGGGCCAAAGG + Intronic
1084159172 11:67335586-67335608 GCCACCGCGCCCAGCCCAAAAGG - Intronic
1084406331 11:68975985-68976007 GCCACCGTGCCCGGCACCACTGG + Intergenic
1085290047 11:75391672-75391694 GCCACCGCGCCCAGCTTCAAAGG + Intergenic
1086227261 11:84527062-84527084 GCCACCGCTCCCGGCCCCACTGG + Intronic
1087745283 11:101937865-101937887 GCCACCGCGCCCGGCCAAAATGG - Intronic
1088305664 11:108404713-108404735 GCCACCGCGCCCGGCCACATGGG + Intronic
1088654831 11:111989336-111989358 GCCACCGCGCCCGGCCCTAGAGG - Intronic
1088940279 11:114447210-114447232 GCCACCGCGCCCGGCCTGAAAGG + Intronic
1088994915 11:114987763-114987785 GCAACCTCTCCTGGTGCCAAGGG + Intergenic
1089894879 11:121919992-121920014 GCCACCGCGCCCGGCCTCACAGG + Intergenic
1090122227 11:124042683-124042705 GCCACCGCACCCGGCCGCAAAGG - Intergenic
1090374654 11:126280286-126280308 GCCACCGCGCCCGATCCCAAAGG - Intergenic
1090582241 11:128173071-128173093 GCCACCGCGCCCGGCCACAATGG - Intergenic
1090796627 11:130141190-130141212 GCCACCGCGCCTGGTGTAAACGG + Intronic
1091284673 11:134402011-134402033 GCCACAGCGCCAGGTTCCAGGGG - Intronic
1091493225 12:950283-950305 GCCACCACGCCCGGCCCCAGGGG - Intronic
1092265321 12:6976436-6976458 GCCACCGTGCCCGGCCCAAAGGG - Exonic
1092350744 12:7753722-7753744 GCCACCGCGCCCGGCCCCCTTGG - Intergenic
1093417881 12:18941533-18941555 GCCACCGTGCCCGGCCTCAAAGG - Intergenic
1094543893 12:31385960-31385982 GCCACCGCACCCGGCTCCATGGG + Exonic
1095500904 12:42837846-42837868 GCCACTGCGCCCAGCGACAAAGG - Intergenic
1095589817 12:43890814-43890836 GCCACTGCGCCCAGCCCCAAGGG + Intronic
1096387211 12:51202615-51202637 GCCACCGCGCCTGGCCTCAAAGG + Intronic
1096832349 12:54324341-54324363 GCCACCGCGCCCAGGCACAACGG + Intronic
1097405764 12:59187916-59187938 GCCACCGCGCCCGGCCTAAATGG - Intergenic
1097641812 12:62191640-62191662 GCGACCGCGGGCGCTGCCAAGGG - Exonic
1098785042 12:74742987-74743009 GCCACCGCGCCCGGCCCTCATGG - Intergenic
1099569945 12:84304624-84304646 GCCACCGCGCCCGGCCCGTATGG - Intergenic
1100072429 12:90736857-90736879 GCCACCGCGCCCGGCCGCAAAGG - Intergenic
1100213886 12:92427625-92427647 GCCACCGCGCCCGGCGGTATTGG - Intronic
1100495136 12:95117755-95117777 GCCACTGCGCCCGGTGGCCTTGG - Intronic
1102865077 12:116367904-116367926 GCCACCGCACCCGGCCCCAAAGG + Intergenic
1103301649 12:119932267-119932289 GCCACCGCGCCCAGCCTCAAGGG - Intergenic
1103369649 12:120409070-120409092 GCCACCGCGCCCGGCCCTAATGG - Intergenic
1103530149 12:121595521-121595543 GCCACCGCGCCCGGCGGCTGTGG + Intergenic
1105308741 13:19187922-19187944 GCCACCGCGCCCGGCCACAAGGG - Intergenic
1105375157 13:19837303-19837325 GCCACCACGTCCGGCCCCAAGGG + Intronic
1105493547 13:20910356-20910378 GCCACCGCACCCGGTGGAAATGG + Intergenic
1105527871 13:21192495-21192517 GCCACCACGCCCGGCACAAATGG + Intergenic
1105928915 13:25033855-25033877 GCCACCGCGCCCGGCCACAATGG - Intergenic
1106046944 13:26151547-26151569 GCCACCGCGCCCGGCCCAGATGG + Intronic
1107633881 13:42372227-42372249 GCCACCGCGCCCGGCCGCAATGG + Intergenic
1107871159 13:44748074-44748096 GCCACCGCGCCCGGCCAGAATGG - Intergenic
1107949749 13:45451290-45451312 GCCACCACGCCCGGTCTGAAAGG + Intergenic
1108142581 13:47440210-47440232 GCCACCGCGCCCAGCCCCAGTGG + Intergenic
1108826900 13:54423249-54423271 GCCACCGTGCCCGGCCCCCATGG + Intergenic
1110183219 13:72642341-72642363 GCCACCGCGCCCGGCCAGAAGGG - Intergenic
1110439988 13:75516984-75517006 GCCACCGCGCCTGGCCGCAAAGG - Intergenic
1112210685 13:97374431-97374453 GCCACCGCGCCCGGCCGCAGTGG + Intronic
1112405035 13:99111883-99111905 GCCACTGCGCCCGGCCTCAAGGG + Intergenic
1113249142 13:108431828-108431850 GCCACCGCGCCCGGCCACCAAGG - Intergenic
1113282027 13:108798989-108799011 GCCACCGCGCCCGGCCCCCGAGG + Intronic
1114622609 14:24105630-24105652 GCCACTGCGCCCGGTGGAATAGG - Intronic
1115340960 14:32292519-32292541 GCCACCGCGCCCGGCCCAGAGGG - Intergenic
1115557242 14:34553340-34553362 GCCACCGCGCCCGGTCTGAATGG - Intergenic
1116056121 14:39866037-39866059 GCCACCGCGCCCGGCCCCCATGG - Intergenic
1116516484 14:45812775-45812797 GCCACCGCGCCCGGCCCCTGAGG + Intergenic
1116824457 14:49658360-49658382 GCCACCGCGCCCGGCCCCTCTGG + Intronic
1116827807 14:49689112-49689134 GCCACCGCGCCCGGGCCCAGAGG - Intergenic
1117667515 14:58072430-58072452 GCCACCGTGCCCGGCCCAAAAGG - Intronic
1118269724 14:64331538-64331560 GCCACTGGGCCCGGCCCCAAAGG - Intronic
1119161137 14:72453327-72453349 GCCACCGCGCCCGGCCCTGAAGG - Intronic
1119751545 14:77081901-77081923 GCCACCGTGCCTGGTGGGAAAGG + Intergenic
1119848622 14:77849112-77849134 GCCACCGCGCCCGGCCACAGTGG + Intronic
1120993815 14:90399721-90399743 GCCACTGCAGCTGGTGCCAAGGG + Intronic
1121005532 14:90488391-90488413 GCCACTGCTCCCGGTCCCACAGG + Intergenic
1121833802 14:97074201-97074223 GCCACCACGCCCGGCCCAAAGGG + Intergenic
1122427778 14:101621672-101621694 GCCACTGTCCCCAGTGCCAAGGG + Intergenic
1122726225 14:103755066-103755088 GCCACCGCGCCCGGTGAGAGAGG + Intronic
1122729787 14:103787530-103787552 GCCACCACGCCCAGTCCCTAGGG - Intronic
1122808083 14:104270834-104270856 GCCACCGCGCCCGGCCGCACAGG - Intergenic
1123675164 15:22703410-22703432 GCCACCGCGCCCGGCCAAAAGGG + Intergenic
1124252924 15:28118882-28118904 GCCACGGCCCCGGGTGCCAGAGG - Intronic
1124327172 15:28776408-28776430 GCCACCGCGCCCGGCCAAAAGGG + Intergenic
1124346717 15:28927855-28927877 GCCACCGCGCCCAGCCCAAAAGG - Intronic
1125255361 15:37757553-37757575 GCCACCGCGCCCAGCCTCAATGG - Intergenic
1125622162 15:41073063-41073085 GCCACCACGCCCGGTGAGTATGG + Intronic
1125874541 15:43132932-43132954 GCCACCGCGCCCGGCAGCATAGG - Intronic
1125971139 15:43912729-43912751 GCCACCGCGCCCGGCCCAAAGGG - Intronic
1126146229 15:45475329-45475351 GCCACCGCACCCGGTGGAAATGG - Intergenic
1126399903 15:48258073-48258095 GCCACCGCGCCCGGCCGTAAAGG - Intronic
1126494668 15:49277509-49277531 GCCACCGCGCCCGGCCAGAAAGG - Intronic
1126636954 15:50789046-50789068 GCCACCATGCCCAGTCCCAAGGG + Intergenic
1127622212 15:60744995-60745017 GCCACCGCGCCCTGTGCTGATGG + Intronic
1127910744 15:63414172-63414194 GCCACCGCGCCTGGCCCAAATGG - Intergenic
1128180752 15:65601625-65601647 GCCACCGCGCCCGGCCCTTAAGG + Intronic
1128358615 15:66945271-66945293 GCCACCGCGCCCGGCCCACAAGG + Intergenic
1129509882 15:76113621-76113643 GCCACCGTGCCCGGTGCTTCAGG - Intronic
1129511191 15:76123997-76124019 GCCACCGTGTCCGGTCCCAAGGG + Intronic
1129590719 15:76912485-76912507 GCCACTGCGCCCAGCGCAAAGGG + Intergenic
1129860326 15:78855536-78855558 GCCACCGCGCCCGGCCCCTTTGG - Intronic
1129883524 15:79022886-79022908 GCCACCGCGCCCGGCCCAGAGGG - Intronic
1130239264 15:82170398-82170420 GCCACCGCGCCCGGCCCCACTGG + Intronic
1130558442 15:84940112-84940134 GCCACCACGCCCGGCTCCAGTGG + Intronic
1131003263 15:88955165-88955187 GCCACATCTCCTGGTGCCAAGGG - Intergenic
1131569381 15:93518739-93518761 GCCACCGTGCCCGGCCCCACTGG + Intergenic
1132155790 15:99494699-99494721 TCCACGGCGCCCGGTCCCATTGG - Intergenic
1132469441 16:93845-93867 GCCACCGCACCCGGCCACAATGG + Intronic
1132755071 16:1480209-1480231 GCCACCGCGCCCGGCCTCTAAGG - Intergenic
1132797813 16:1733925-1733947 GCTCCCACGGCCGGTGCCAAAGG - Intronic
1132875979 16:2137562-2137584 GCCACCACGCCCGGCCCCCATGG - Intergenic
1133007693 16:2893922-2893944 GCCACCGCGCCCGGCCCCTTTGG + Intronic
1133084373 16:3350339-3350361 GCCACCGCGCCCAGCCCAAAGGG + Intergenic
1133746589 16:8691725-8691747 GCCACCGCGCCCAGTGCCAAGGG + Intronic
1133942309 16:10319790-10319812 GCCACTGCGCCCAGTTACAATGG + Intergenic
1134137050 16:11684035-11684057 GCCACCACGCCTGGTTCCTAAGG + Intronic
1134144524 16:11749459-11749481 GCCACCGCGCCCGGCCTCAGGGG - Intergenic
1134480257 16:14613021-14613043 GCCACCGCGCCCCGTCCCCATGG - Intronic
1134975267 16:18565715-18565737 GCCACCGTGCCCAGTTGCAATGG + Intergenic
1135009768 16:18864761-18864783 ACCACCGCGCCCAGCCCCAAAGG + Intronic
1135057209 16:19241231-19241253 GCCACCGCGCCCGGCCCCCTAGG + Intronic
1136048345 16:27633034-27633056 GCCACCGCGCCCGGCCGAAAAGG + Intronic
1136161935 16:28425795-28425817 GCCACCACGCCCGGCCCCATGGG - Intergenic
1136201030 16:28689193-28689215 GCCACCACGCCCGGCCCCATGGG + Intronic
1136217372 16:28803379-28803401 GCCACCACGCCCGGCCCCATGGG + Intergenic
1136313471 16:29432392-29432414 GCCACCGCGCCCAGCCCCAAAGG + Intergenic
1136326913 16:29534158-29534180 GCCACCGCGCCCAGCCCCAAAGG + Intergenic
1136340421 16:29639459-29639481 GCCACCGCACCCGGTGAGACAGG - Intergenic
1136441604 16:30274142-30274164 GCCACCGCGCCCAGCCCCAAAGG + Intergenic
1138069510 16:53978708-53978730 GCCACCGCACCCGGTGATTATGG - Intronic
1138600908 16:58053462-58053484 GCCACCGCGCCCGGCCACATGGG + Intergenic
1138901627 16:61276977-61276999 GCCACCGCGCCCGGCCGAAAAGG + Intergenic
1139094902 16:63693684-63693706 GCCACCGCGCCCGGCCGCATCGG + Intergenic
1139236062 16:65340741-65340763 GCCACCGCGCCCGGCCGCTAAGG - Intergenic
1139794199 16:69469034-69469056 GCCACCGCGCCCGGCCAGAAAGG - Intergenic
1139888395 16:70227876-70227898 GCCACCGCGCCCAGCCCCAAAGG + Intergenic
1139906440 16:70369462-70369484 GCCACCGCGCCTGGCCCCCAGGG + Intronic
1140098707 16:71896035-71896057 GCCACCCCGCCCGGTGGAAGCGG - Intronic
1140200160 16:72888531-72888553 GCCACAGTGCCCTGTGCCCAGGG + Intronic
1140344284 16:74197271-74197293 GCCACCACGCCCGGCCCCACTGG + Intergenic
1140497733 16:75404505-75404527 GCCACCGCGCCCGGCCGCAAAGG + Intronic
1140552496 16:75881973-75881995 GCCACCGCGCCCGGCAACACTGG + Intergenic
1140711012 16:77677684-77677706 GCCACCGCACCCGGCCCCACTGG - Intergenic
1140976088 16:80061604-80061626 GCCACCGCGCCCGGCCCAGATGG + Intergenic
1141534071 16:84666780-84666802 GCCACTGCGCCCGGCCCCAAAGG - Intronic
1141915287 16:87092389-87092411 GCCACCGCGCCTGGCCGCAAAGG - Intronic
1142393094 16:89815768-89815790 GCCACCGCGCCCGCCGCCTCGGG + Intronic
1142518067 17:446299-446321 GCCACCGCACCCGGCCCCCACGG + Intergenic
1143147699 17:4787326-4787348 GCCACCGCGCCCGGTCCAACAGG + Intergenic
1143246968 17:5495133-5495155 GCCACCGCGCCTGGCGTCTAAGG - Intergenic
1143459844 17:7095311-7095333 GCCACCGCGCCCGGCCTCAAGGG - Intergenic
1143733039 17:8891888-8891910 GCCACCGCGCCCGGCTACTATGG + Intronic
1143753882 17:9052255-9052277 GCCACCACTCCCGGCCCCAAAGG + Intronic
1144113901 17:12066961-12066983 GCCACCGCGCCCGGCCCACATGG + Intronic
1144216476 17:13059619-13059641 GCCACCGCGCCCGGCTGCAAGGG - Intergenic
1144783147 17:17817753-17817775 GCCACTGCCCCTGCTGCCAAGGG + Exonic
1144962405 17:19052347-19052369 GCCACCGCACCCGGCCCAAAAGG + Intergenic
1144972756 17:19122173-19122195 GCCACCGCACCCGGCCCAAAAGG - Intergenic
1146904981 17:36612456-36612478 GGCACCGCGCCAGGTACCAGAGG - Intergenic
1147336858 17:39731359-39731381 GCCACCACGCCCGGTGCTGATGG + Intergenic
1147355946 17:39896849-39896871 GCCACCGCGCCCGGCCCCAATGG + Intergenic
1147962146 17:44174329-44174351 GCCACCGCGCCCGGCCCAACTGG + Intronic
1147985401 17:44304341-44304363 GCCACCACGCCCGGCCACAAGGG - Intergenic
1148019792 17:44546066-44546088 GCCACTGCAACCGGTCCCAATGG - Intergenic
1148078152 17:44951506-44951528 GCCACTGCGCCCGGCCTCAAGGG + Intergenic
1148111253 17:45145710-45145732 GCCACCGCGCCCGGCCCCCTTGG + Intergenic
1148409975 17:47457836-47457858 GCCACCGCGCCCGGCCTGAAGGG + Intergenic
1148803192 17:50246095-50246117 GCCACCGCGCCCGGTTAAACTGG + Intergenic
1148947271 17:51274735-51274757 GCCACCGCGCCCAGCGACATAGG + Intronic
1148963026 17:51409341-51409363 GCCACCGCGCCTGGTCCACAGGG - Intergenic
1149439656 17:56663770-56663792 GACACTGAGCCAGGTGCCAAGGG + Intergenic
1149663562 17:58350225-58350247 GCCACAGCGCCCGGCTGCAATGG - Intronic
1149683117 17:58519302-58519324 GCCACCGCGCCCGGCCCAAAAGG - Intergenic
1149753319 17:59166875-59166897 GCCACCGCGCCCGGTCCTATAGG - Intronic
1149799757 17:59556638-59556660 GCCACCGCGCCCGGCACAACTGG - Intergenic
1149922452 17:60672526-60672548 GCCACTGCGCCCGGTGCATTTGG + Intergenic
1150026521 17:61680763-61680785 GCCACCGCGCCTGGCCCTAAAGG + Intergenic
1150030383 17:61728113-61728135 GCCACCGCGCCTGGCCACAAAGG + Intronic
1151261507 17:72919518-72919540 GCCACCACGCCCGGTTCCCTTGG - Intronic
1151636614 17:75353474-75353496 GCCACCGCGCCCGGTAAAAATGG - Intronic
1151700342 17:75739584-75739606 GCCACCCCGCCCCATGCCAATGG - Intronic
1151701386 17:75744404-75744426 GCCACCGCGCCCGGCCCAAGAGG + Intronic
1151707760 17:75779592-75779614 GCCGCGGCGCGCGGCGCCAACGG + Intronic
1151722065 17:75862775-75862797 GCCACTGCGCCCGGCTCCAAGGG - Intergenic
1151837374 17:76591319-76591341 ACCACCGCGCCCGGCCGCAATGG + Intergenic
1152613416 17:81326995-81327017 GCCACCTCGCCCGGCCCCAACGG + Intronic
1152664917 17:81562250-81562272 GCCACCGCGCCCGGCCCTCATGG - Intronic
1152724369 17:81937798-81937820 GCCACCGCGCCCGGCCCAAATGG - Intronic
1153308865 18:3657888-3657910 GCCACCGCGCCCGGCTCCCATGG + Intronic
1153550027 18:6252915-6252937 GCCACCGCACCCGGCCCCAGGGG - Intronic
1154071649 18:11157777-11157799 GCCACCGCGCCCGGCCCGAATGG + Intergenic
1154929037 18:20973163-20973185 GCCACCACGCCCGGTGTAAGAGG + Intronic
1155270675 18:24138936-24138958 GCCACAGCGGCCGCAGCCAATGG - Exonic
1155503808 18:26513371-26513393 GCCACCGCGCCCGGCCTCCAGGG + Intronic
1156306773 18:35884869-35884891 GCCACCGCGCCCGGCCAGAAGGG - Intergenic
1157726660 18:49969666-49969688 GCCACCGCGCCCGGCCTTAAAGG + Intronic
1157835104 18:50894275-50894297 GCCACCGCGCCCGGCCAAAAAGG - Intronic
1158121214 18:54050246-54050268 GCCACCGCGCCCGGCCCTGAAGG + Intergenic
1158268248 18:55683716-55683738 GCCACCGCGCCCGGCCCAAAAGG - Intergenic
1158599662 18:58846591-58846613 GCCACCGCGCCCAGCGGAAAAGG - Intergenic
1159179114 18:64878344-64878366 GCCACCGCGCCCGGCCTCACTGG + Intergenic
1159535662 18:69711993-69712015 GCCACCGCGCCCGGCCGAAAAGG - Intronic
1159549804 18:69882952-69882974 GCCACCACGCCTGGCTCCAAGGG + Intronic
1159763628 18:72459435-72459457 GCCACCGCGCCCGGCCGAAAAGG - Intergenic
1160881699 19:1323710-1323732 GCCACCGCGCCCGGCCGCAAAGG - Intergenic
1160945694 19:1642756-1642778 GCCACCGCGCCCGGTCACAAGGG + Intronic
1160955352 19:1688794-1688816 GCCACCGCGCCCGGCCAGAAGGG - Intergenic
1160955577 19:1690181-1690203 GCCACCGCGCCCGGCGAGACTGG + Intergenic
1161023118 19:2020897-2020919 GCCACTGCGCCCGGCTCCTAAGG - Intronic
1161223507 19:3130843-3130865 GCCACCGCGCCCGGATCTTAGGG - Intergenic
1161355918 19:3819565-3819587 GCCACCGCGCCCGGCCTCAATGG - Intronic
1162012783 19:7828433-7828455 GCCACCGCGCCCGGACCCTGGGG + Intergenic
1162072399 19:8161901-8161923 GCCACCGCGCCCGGTCCCAATGG - Intronic
1162434791 19:10651415-10651437 GCCACCGCGCCCGGCGTCTTTGG + Intergenic
1162611472 19:11757951-11757973 GCCACCGAGCCCGGCCTCAAGGG + Intergenic
1162733316 19:12731834-12731856 GCCACCGCGCCTGGTCAAAAAGG - Intronic
1163246224 19:16096350-16096372 GCCACCGCGCCCATCCCCAATGG + Intronic
1163258937 19:16175043-16175065 GCCACCTCGCCCGGCCCAAAGGG + Intergenic
1163559386 19:18009937-18009959 GCCACAGCGCCCGCTGCCCGGGG - Exonic
1163661146 19:18578399-18578421 GCCACTGCGCCCGGCCCCCATGG + Intronic
1163908777 19:20170181-20170203 GCCACCGCGCCCGGCCAAAATGG + Intronic
1165562079 19:36688519-36688541 GCCACCGCGCCCGGCCCGCATGG - Intronic
1167199708 19:48055908-48055930 GCCACCGCGCCCGGCCGTAAAGG + Intronic
1167274356 19:48527601-48527623 GCCACCGTGCCCGGCCCCCAGGG + Intergenic
1167409425 19:49336267-49336289 GCCACCGCGCCCGGCCCCTAGGG - Intronic
1167436338 19:49480743-49480765 GCCACCGCGCCTGGCCCCAGAGG - Intronic
1167444433 19:49528893-49528915 GCCACCACGCCCGGTCTCAAAGG - Intronic
1167456234 19:49597781-49597803 GCCACGGCGCCGGGGGCCATCGG - Exonic
1167582816 19:50356485-50356507 GCCACCACGCCCGGTGGAGACGG - Intronic
1167847607 19:52177264-52177286 GCCACCGTGCCCGGCCCAAAGGG - Intergenic
1168069260 19:53940766-53940788 GCCACCGCGCCCGGCCTTAAAGG - Intronic
1168166724 19:54553703-54553725 GCCACCGCGCCCGGCCTCAATGG + Intergenic
1168394169 19:56034100-56034122 GCCACCGCGCCCGGCCCAGAAGG - Intronic
925595862 2:5555142-5555164 GCCACCGCGCCCGGCCCGGAAGG + Intergenic
925730663 2:6917754-6917776 GCCCCGGCGCCCGGTGGCAGCGG + Intronic
926145351 2:10393826-10393848 GCCACCACGCCCGGGCCTAAAGG - Intronic
926321672 2:11752715-11752737 GCCACCGCGCCCGGCCTCCAAGG + Intronic
926778730 2:16447716-16447738 GCCACCGCGCCCGGCCCTATTGG + Intergenic
927183637 2:20466911-20466933 GCCACCGCGCCCGGCCCACATGG - Intergenic
927687923 2:25185169-25185191 GCCACCGCGCCTGGCCTCAAAGG + Intergenic
928496659 2:31839757-31839779 GCCACCATGCCCGGCCCCAAGGG + Intergenic
928723066 2:34142556-34142578 TCCACAGCGCCCGGTCCCATCGG - Intergenic
928775634 2:34759751-34759773 GCCACCGCGCCCGGTCAACACGG - Intergenic
929656072 2:43733074-43733096 GCCACTGCGCCCGGCTGCAAGGG - Intronic
931421256 2:62129887-62129909 GCCACGGCGCCCGGCTCAAAGGG - Intronic
932033137 2:68211118-68211140 GCCACCGCGCCCAGCCGCAATGG - Intronic
932492928 2:72132989-72133011 CCCATCGCCCCCGGTGCCACGGG + Intronic
932772121 2:74506289-74506311 GCCACCGCGCCCGGCCCCGAAGG - Intronic
932903223 2:75723845-75723867 GCCACAGCACCCGGTGCCAATGG + Intergenic
932987614 2:76746095-76746117 GCCACCGCGCCCGGCTACATGGG - Intergenic
933036954 2:77411754-77411776 GCCACCGCGCCCGGCCCCCAGGG + Intronic
933456206 2:82522970-82522992 GCCCCCGCGCCCGGCTGCAAAGG + Intergenic
933692041 2:85186251-85186273 GCCACCGCGCCCGGCCGCAGGGG + Intronic
934097171 2:88617511-88617533 GCCACCGCACCTGGCCCCAATGG - Intronic
934653784 2:96106980-96107002 GCCACCGCGCCCGGTCCACGTGG + Intergenic
934971895 2:98770574-98770596 GCCACCGCGCCCGGCCCCTAGGG - Intergenic
936432120 2:112473756-112473778 GCCACCGCGCCTGGTCCCCTTGG - Intergenic
937226629 2:120374126-120374148 GCCACTGCGCCCGGCCCCCAGGG - Intergenic
937283179 2:120734646-120734668 GCCACCGCGCCCGGCCCAACAGG + Intergenic
937624352 2:124026110-124026132 GCCACCGTGCTCGGTGACAGTGG + Intronic
939024334 2:136994278-136994300 GCCACCGCGCCCGGCCCTATAGG - Intronic
939216614 2:139246769-139246791 GCCACCGCGCCCAGCCTCAAGGG + Intergenic
940229854 2:151439376-151439398 GCCACCGCGCCCGGCTAGAAGGG - Intronic
942273856 2:174303660-174303682 GCCACCGCGCCCAGTGAGAAAGG - Intergenic
942543632 2:177040039-177040061 GCCACCGCGCCCGGCCCCCGAGG - Intergenic
943925961 2:193780213-193780235 GCCACCGCGCCCGGCCTTAAAGG + Intergenic
945092247 2:206186395-206186417 GCCACCGCGCCCGGCCGGAATGG + Intronic
945189730 2:207175072-207175094 GCCACCGCGGCCGGCCCAAATGG - Intergenic
946582285 2:221142649-221142671 GCCACTGCACCCGGTGTGAATGG - Intergenic
946629081 2:221646827-221646849 GCCACCGCGCCTGGCTGCAAAGG - Intergenic
947045709 2:225980941-225980963 GCCACCGCGCCCGGCCTCAGTGG + Intergenic
948621197 2:239235751-239235773 GCCACCGCGCCCAGCCCCATAGG - Intronic
949018110 2:241724924-241724946 GCCAGCGCGCAGGGTGCCCAGGG - Intronic
1168796909 20:616596-616618 GCCACCGCGCCTGGCCACAAGGG + Intergenic
1169405996 20:5321794-5321816 GCCACCGCGCCCGGCCAGAAAGG + Intergenic
1170492148 20:16888008-16888030 GCCACCGTGCCCGGCTCCAAAGG + Intergenic
1170606803 20:17880755-17880777 GCCACCGCGCCCAGACCCCATGG + Intergenic
1170618807 20:17976945-17976967 GCCACCACGCCCGGTCCCCATGG + Intronic
1171446082 20:25205752-25205774 GCCACAGTGCCCCGTGCCGAGGG - Intronic
1172081865 20:32347983-32348005 GCCACCGCGCCCGGCCCCCAAGG + Intergenic
1172345638 20:34196457-34196479 GCCACCGCGCCCGGCTGAAAAGG + Intronic
1172350258 20:34233431-34233453 GCCACCGCGCCCGGCCCACATGG + Intronic
1172873381 20:38149389-38149411 GCCACCGCGCCCGGCCCACAGGG - Intronic
1173605281 20:44327034-44327056 GCCTCCACACCCGGTGCCAGGGG - Intergenic
1174355332 20:49994073-49994095 GCCACTGCGCCCGGCCCAAACGG + Intergenic
1174369917 20:50079631-50079653 GCCACCGCGCCCGGCTACACTGG + Intergenic
1174863849 20:54116588-54116610 GCCTCCCCGCCCTGTTCCAATGG - Intergenic
1175115356 20:56678163-56678185 GCCACCGCGCCCGGCCCTAGAGG - Intergenic
1175792278 20:61747153-61747175 GCCACCGCGCCCGGTCCCTGTGG - Intronic
1176200193 20:63856580-63856602 GCCACCGCGCCCGGCCCCAAGGG - Intergenic
1176388246 21:6150423-6150445 GCCACCGTCCCCAGCGCCAAGGG - Intergenic
1177154236 21:17485335-17485357 GCCACCGCGCCCGGCTGCCATGG + Intergenic
1177379209 21:20316427-20316449 GCCACCGCGCCCGGCCCACAAGG + Intergenic
1177961766 21:27675826-27675848 GCCACCGCGCCCGGCCCAAAGGG - Intergenic
1178312293 21:31539549-31539571 GCCACCGCGCCCGGCCGGAATGG + Intronic
1179307440 21:40167778-40167800 GCCACCGTGCCCGGCCACAAGGG - Intronic
1179735226 21:43387825-43387847 GCCACCGTCCCCAGCGCCAAGGG + Intergenic
1180122144 21:45760797-45760819 GCCACCGCGCCCGGCCTCAATGG - Intronic
1180616391 22:17131107-17131129 GCCACCGCGCCCGGCCCCTTTGG - Intronic
1180644322 22:17326044-17326066 GCCACCGCGCCCAGCCCAAATGG - Intergenic
1180653720 22:17401051-17401073 GCCACCGCGACCAGTCCCCAGGG + Intronic
1181477966 22:23180407-23180429 GCCCCCCCGCCCTGTGCCCACGG + Exonic
1181663471 22:24372005-24372027 GCCACCGCGCCCGGTCTCAAAGG + Intronic
1181938489 22:26456372-26456394 GCCACCACGCCCGGCTTCAAGGG - Intronic
1182588383 22:31360110-31360132 GCCACCAAGCCTGGTGCCTAAGG + Intergenic
1182923660 22:34103009-34103031 GCCACCGCGCCCGGCCCTGAGGG - Intergenic
1183450587 22:37892640-37892662 GCCACTGTGCCCGGGCCCAAAGG + Intergenic
1183747370 22:39699305-39699327 GCCACCGCGCCCGGCCTCTAAGG + Intergenic
1183764223 22:39855985-39856007 GCCACCGCGCCCGGCCACGAGGG - Intronic
1183851258 22:40590380-40590402 GCCACCGCGCCCGGCTACACTGG - Intronic
1183963232 22:41425393-41425415 GCCACCGCGCCCGGCCAGAAGGG - Intergenic
1184509144 22:44921943-44921965 GCCACCGCGCCCGGTCCTGATGG + Intronic
1184974214 22:48049495-48049517 GCCACCACGCCCGGTGAAAATGG - Intergenic
1185332904 22:50259594-50259616 GCCACCGCGCCGGGCTCCACCGG - Intronic
949331998 3:2933106-2933128 GCCACCGCGCCCGGCCCAGATGG + Intronic
949351296 3:3127072-3127094 GCCACCGCGCCCGGTCCTCGAGG + Intronic
950008700 3:9707065-9707087 GCCACCGCGCCTGGCCCCCAAGG - Intronic
950100849 3:10355785-10355807 GCCACCGCGCCCGGCCGGAAAGG - Intronic
950854999 3:16096574-16096596 GCCACTGCACCCGGCCCCAAAGG - Intergenic
952084128 3:29796996-29797018 GCCACCGAGCCCGGCCACAATGG + Intronic
952770474 3:36995230-36995252 GCCACCGCGCCCGGCTCAAGTGG + Intronic
953169112 3:40491492-40491514 GCCACCGCGCCCGGCCACAAAGG + Intergenic
953169124 3:40491563-40491585 GCCACCGCGCCCGGCCACAAAGG - Intergenic
953991001 3:47483354-47483376 GCCACCGCACCTGGCCCCAATGG + Intergenic
954273452 3:49527103-49527125 GCCACCGCACCCGGCCACAAGGG - Intronic
954868997 3:53752682-53752704 GCCACCGCGCCCGGCACCTTTGG + Intronic
955673667 3:61428195-61428217 GCCACCGTGCCCGGCCGCAAAGG - Intergenic
955685390 3:61544068-61544090 GCCACCGCGCCCGGCCCAACTGG - Intergenic
956092136 3:65679409-65679431 GCCACCGTGCCCGGCCCCAGGGG - Intronic
956346177 3:68281742-68281764 GCCACCGCGCCTGGTCCCATGGG + Intronic
956827131 3:73007773-73007795 GCCACCGCGCCCGGCCTCTATGG + Intronic
956902270 3:73729089-73729111 GCCACCGCGCCCGGCAACACAGG + Intergenic
956980831 3:74635150-74635172 GCCACTGCACCTGGTGACAAAGG + Intergenic
961049841 3:123736944-123736966 GCCACCACGCCCGGCCACAAGGG - Intronic
962220803 3:133563191-133563213 GCCACCGCGCCCGGCACTGATGG + Intergenic
962229153 3:133645860-133645882 GCCACCGCGCCCGGCCCTAGGGG - Intronic
962603793 3:137014990-137015012 GCCACCGCGCCCGGCCACCAGGG - Intergenic
963034426 3:141013224-141013246 GCCACCGCGCCCGGCCACTAAGG - Intergenic
963110543 3:141684307-141684329 GCCACCGCGCCCGGCCCCACAGG + Intergenic
963753102 3:149203191-149203213 GCCACTGCGCCCGGCCCCAGTGG + Intronic
963939226 3:151084120-151084142 GCCACCGCGCCCGGCCGAAAGGG - Intergenic
964216528 3:154290846-154290868 GCCACCGCGCCCGGCCTCAATGG - Intronic
964360693 3:155892916-155892938 GCCACCGCGCCCGGCCTAAAAGG + Intronic
965338700 3:167459358-167459380 GCCACCGCGCCCGGCCCCAAAGG + Intronic
965740617 3:171870334-171870356 GCCACCGCACCCGGCCCCAAAGG + Intronic
966372700 3:179265742-179265764 GCCACCGCGCCTGGCACAAAAGG + Intronic
966392284 3:179465315-179465337 GCCACCGCGCCCGGCCATAATGG - Intergenic
966908892 3:184547007-184547029 GCCACCGCGCCCGGCGGCTTTGG + Intronic
967194043 3:187011283-187011305 GCCACCGTGCCCGGAGAAAAAGG + Intronic
967547927 3:190753591-190753613 GCCACTGCGCCCGGCCCAAAAGG + Intergenic
967663193 3:192138302-192138324 GCCACCGCGCCCGGCCTCAAAGG - Intergenic
968116135 3:196091376-196091398 GCCACCGCGCCAGGCCCCACTGG + Intergenic
968666298 4:1824034-1824056 GCCACCGCGCCCGGCCCCTGGGG - Intronic
968696978 4:2035644-2035666 GCCACCGCGCCCGGCCTAAAGGG + Intronic
968835270 4:2959304-2959326 GCCACCGCGCCCGGCCCCAAAGG - Intronic
969263873 4:6051524-6051546 GCCACCTCGCCCGGCCCCAAAGG + Intronic
972617715 4:40715984-40716006 GCCACCGCGCCCAGCCCCTATGG - Intergenic
972696466 4:41451410-41451432 GCCACCGTGCCCGGCCCGAAAGG + Intronic
973958552 4:56087297-56087319 GCCACCGCGCCCAGCCCTAAAGG + Intergenic
975147741 4:70989130-70989152 GCCACCGCGCCCGGCCCACAGGG - Intronic
975868450 4:78750871-78750893 GCCACCGCACCTGGCCCCAAAGG - Intergenic
976249353 4:83034629-83034651 GCCACCGCGCCCGGCCGAAAGGG + Intronic
977453994 4:97234900-97234922 GCCACCGCGCCCGGCCCCAGTGG - Intronic
977818470 4:101443467-101443489 GCCACCGCGCCCGGCCTTAAAGG + Intronic
980129891 4:128808785-128808807 GCCACCGCGCCCGGCCTGAATGG + Intergenic
981008425 4:139899519-139899541 GGCTCTGCGCCAGGTGCCAAAGG + Intronic
984100908 4:175484713-175484735 GCCACCGCGCCCGGCCTCAAAGG - Intergenic
984533226 4:180943723-180943745 GCCACTGCGCCCGGCCCCATAGG + Intergenic
984761109 4:183363790-183363812 GCCACTGCACCCGGCGGCAAAGG + Intergenic
985913155 5:2898352-2898374 GCCACCGCGCCCGGGCCACAGGG + Intergenic
986166086 5:5272649-5272671 GCCACTGCCCCCGGCCCCAAAGG + Intronic
986384058 5:7214033-7214055 GCCACCGCGCCCGGCCAGAAAGG + Intergenic
987005449 5:13705277-13705299 GCCACTGCGCCCGGCTGCAATGG + Intronic
988295144 5:29348291-29348313 GCCACCGCGCCCGGCCAGAAAGG + Intergenic
988472893 5:31557347-31557369 GCCACCGCGCCCGGCCACAGGGG - Intergenic
988609532 5:32711838-32711860 GCCACCGCCACCGGTGCCGCCGG - Exonic
989118554 5:37980531-37980553 GCCACTGTGCCCAGTGACAAAGG + Intergenic
990383463 5:55236807-55236829 GCCACCGCGCCCGGCCACACTGG + Intergenic
990437870 5:55812273-55812295 ACCACCGCGCCCGGCCCCTACGG - Intronic
990550233 5:56868668-56868690 GCCACCGCGCCCGGCCGTAATGG + Intronic
991059994 5:62364430-62364452 GCCACCGCGCCCGGCCCAGAGGG + Intronic
991672001 5:69057069-69057091 GCCACCGCGCCCGGCCACAATGG - Intergenic
992205640 5:74427900-74427922 GCCACCGCGCCCGGCCGCAAAGG - Intergenic
993696471 5:91067427-91067449 GCCACCGCGCCTGGCCGCAAAGG + Intronic
993926453 5:93872232-93872254 GCCACTGTGCCCGGTCCCACTGG + Intronic
994367353 5:98930195-98930217 GCCACGGCGCCCGGTGGCCGAGG + Intergenic
994484183 5:100374538-100374560 GCCACCGCGCCAGGTGGGATAGG + Intergenic
995204831 5:109467811-109467833 GCCACCGCGCCCGGCCCCAATGG - Intergenic
995861705 5:116647856-116647878 GCCACCGCGCCTGGCCGCAAAGG + Intergenic
996919003 5:128745450-128745472 GCCACCGCGCCCGGCCCCTCAGG + Intronic
997533746 5:134599528-134599550 GCCACCGTGCCCGGCTCCATAGG + Intergenic
997550100 5:134745149-134745171 GCCACCGCGCCCCGCCTCAAAGG - Intronic
997891487 5:137680885-137680907 GCCACTGTGCCTGGTCCCAAGGG - Intronic
997938241 5:138133389-138133411 GCCACCGCGCCCGGCCTTAAGGG + Intronic
998249576 5:140542806-140542828 GCCACCGCACCCGGCCCCAAAGG - Intronic
999169332 5:149580345-149580367 GCCACCGCGCCCGGCACCCTTGG + Intronic
999614782 5:153411425-153411447 GCCACCGCGCCCGGCCCTTAAGG + Intergenic
1000738881 5:164939587-164939609 GCCACCGCGCCCGGCCTCTAAGG + Intergenic
1001279685 5:170377856-170377878 GCCACCGCGCCCGGCCCAGAGGG + Exonic
1001540214 5:172532603-172532625 GCCACCGTGCCCGGTCCAAATGG + Intergenic
1001800310 5:174537890-174537912 GCCGCCGTGCCCGGCCCCAATGG + Intergenic
1002546182 5:179946838-179946860 GCCACCGCGCCCAGCACCATAGG + Intronic
1002578373 5:180191640-180191662 GCCACCGCGCCCGGCCACAGTGG + Intronic
1003152517 6:3564548-3564570 GCCACCGCGCCCGGCCTCATGGG + Intergenic
1003509871 6:6770940-6770962 GCCACCGCGCCCTGCCCAAATGG - Intergenic
1004168998 6:13281265-13281287 GCCACCGAGCCCGGCCCAAAGGG - Intronic
1005003654 6:21267038-21267060 GCCACCGTGCCCGGCCCCCATGG + Intergenic
1005388229 6:25307165-25307187 GCCACCGCGCCCGGTCGCCCTGG + Intronic
1005618097 6:27594424-27594446 GCCACCGCGCCCGGCCCCCAGGG - Intergenic
1005956497 6:30667294-30667316 GCCACCGCGCCCGGCCGAAATGG - Intronic
1006558146 6:34887015-34887037 GCCACCGCACCCGGTGATCAGGG - Intronic
1006660740 6:35641716-35641738 GCCACCGTGCCCGGCCCAAAGGG - Intronic
1006692323 6:35899713-35899735 GCCACCGTGCCCGGCCCCAAAGG - Intronic
1006860183 6:37166985-37167007 GCCACCGCGCCCAGCCCAAACGG - Intergenic
1006987115 6:38183261-38183283 GCCACCGCGCCCGGCCTAAAAGG + Intronic
1007162804 6:39805836-39805858 GCCACCGTGCCCGGCCCCTAAGG + Intronic
1007673525 6:43576155-43576177 GACAGCGCGCCCGCTGCGAAGGG - Exonic
1010543044 6:77116253-77116275 GCCACCGTGCCCGGCCCCAGTGG - Intergenic
1012009765 6:93768527-93768549 GCCACCGCGCCCGGCCATAATGG - Intergenic
1012022147 6:93936863-93936885 GCCACCGCGCCCGGCCACATTGG - Intergenic
1012409060 6:98935501-98935523 GCCACCGCGCCCGGCCCAGATGG - Intronic
1012742505 6:103036553-103036575 GCCACCATGCCCGGTCCCAATGG - Intergenic
1012991209 6:105928525-105928547 GCCACCGCGCCCGGCGGGAATGG - Intergenic
1012999460 6:106008084-106008106 GCCACCGCGCCCAGCCCCACTGG - Intergenic
1013669091 6:112378492-112378514 GCCACTGCGCCCGGCCACAAAGG + Intergenic
1013974183 6:116058622-116058644 GCCACCGCGCCCGGCCAAAATGG - Intronic
1015538618 6:134292304-134292326 GCCACCGCGCCCGGCCCCCTGGG - Intronic
1015927317 6:138323323-138323345 GACACCGCGCCCGGCCACAAAGG - Intronic
1016024466 6:139272020-139272042 GCCACCACGCCCAGCCCCAATGG - Intronic
1017015205 6:150094324-150094346 GCCACCGCGCCCGGCCACAGAGG - Intergenic
1017286788 6:152685439-152685461 GCCACCGCGCCCGGACCCAAAGG - Intergenic
1017902898 6:158733809-158733831 GCCACCGCGCCCGGCCAAAAGGG - Intronic
1019376628 7:696247-696269 GCCACAGCACCCGGCCCCAATGG + Intronic
1019376676 7:696558-696580 GCCACCGCGCCCGGCCTCAATGG + Intronic
1019397991 7:833595-833617 GCCACCGTGCCCGGTCTCAGTGG + Intronic
1019714304 7:2531268-2531290 GCCACCACGCCTGGCCCCAAGGG - Intergenic
1019724215 7:2592071-2592093 GCCACCGCGCCCGGCCCTACAGG + Intronic
1019817383 7:3211200-3211222 GCCACCGTGCCCGGCCCTAAAGG + Intergenic
1020052703 7:5092505-5092527 GCCACCGCGCCCGGCCTCAGAGG + Intergenic
1020783019 7:12539176-12539198 GCCACTGCGCCCGGCCCTAAAGG - Intergenic
1020885577 7:13815661-13815683 GCCACCGCGCCCGGCCTAAAGGG - Intergenic
1021655050 7:22866338-22866360 GCCACTGCGCCCAGTGGCACTGG + Intergenic
1021719376 7:23490959-23490981 GCCTCTGCGCACGGTGACAATGG - Intergenic
1021864752 7:24944340-24944362 GCCACCGCGCCCGGCCACCATGG - Intronic
1022738388 7:33097904-33097926 GCCACCACGCCCGGCCCAAAAGG + Intronic
1023169210 7:37374463-37374485 GCCGCCACTCCCGGTGCCAAGGG - Intronic
1023522511 7:41062360-41062382 GCCACCGCGCCCGGCTGCACCGG + Intergenic
1024811464 7:53217457-53217479 GCCACCACGCCCGGCCCCATTGG - Intergenic
1026024657 7:66734717-66734739 GCCACCGTGCCTGGCCCCAAAGG + Intronic
1026030138 7:66785586-66785608 GCCACCGCACCCGGCCACAAAGG - Intronic
1026091574 7:67304743-67304765 GCCACCGCGCCTGGCCCCAAAGG + Intergenic
1026098110 7:67362981-67363003 GCCACCGCACCCGGCTACAATGG + Intergenic
1026206705 7:68263927-68263949 GCCACCGCGCCTGGCCCTAAAGG - Intergenic
1026465452 7:70649811-70649833 GCCACCGCACCCGGCCCCAGTGG + Intronic
1026984840 7:74548129-74548151 GCCACCGCGCCCGGGCCCAAAGG - Intronic
1027175948 7:75903603-75903625 GCCACCGCGCCCGGCCCTCAGGG - Intronic
1028902183 7:96113848-96113870 GCCACCGCGCCCGGCCTCAAAGG + Intergenic
1029490908 7:100869344-100869366 GCCACCGCGCTCAGCCCCAATGG - Intronic
1031012273 7:116536715-116536737 GCCACCGCGCCCGGCCTTAATGG - Intronic
1031695310 7:124844448-124844470 GCCACCGCGCCCGGTGCCAATGG - Intronic
1032021872 7:128411186-128411208 GCCACCGCGCCCGGCGCATCTGG + Intergenic
1032132124 7:129238663-129238685 GCCACCGCGCCCGGCCACAGAGG - Intronic
1033060475 7:138101482-138101504 GCCACCGCGCCCGGCAACATAGG + Intronic
1033165988 7:139039178-139039200 GCCACCGCGCCCGGTCTTACTGG - Intergenic
1033349510 7:140550744-140550766 GCCACCGCGCCTGGCCTCAATGG + Intronic
1034032317 7:147781735-147781757 GCCACCGCGCCCGGCCTGAATGG - Intronic
1034102224 7:148459622-148459644 GCCACCGCGCCCGGCAACAAAGG - Intergenic
1034175697 7:149097983-149098005 GCCACCGCGCCCGGCCAAAATGG + Intergenic
1034676342 7:152895150-152895172 GCCACCACGCCCGGCCCCAGTGG - Intergenic
1035202318 7:157275623-157275645 GCCACCGCGCCCGGCTACATGGG + Intergenic
1036525974 8:9535201-9535223 GCCACCGCGCCCGGCCAAAATGG - Intergenic
1036609771 8:10339825-10339847 GCCACCACGCCCGGCAGCAAGGG + Intronic
1036699709 8:11004185-11004207 GCCACCACGCCCGGCCCCACAGG - Intronic
1036797570 8:11767503-11767525 GCCACCGCGCCCGGCCCTAGGGG - Intergenic
1038789909 8:30658831-30658853 GCCACCGCGCCCGGCCTCAACGG + Intergenic
1038942089 8:32316189-32316211 GCCACCGCGCCCGGTCCCTTAGG - Intronic
1039601872 8:38846004-38846026 GCCACCGCGCCCGGCCTGAAAGG - Intronic
1039880218 8:41621023-41621045 GCCACCGTGCGGGGTGCCAACGG + Exonic
1041067896 8:54099968-54099990 GCCACCGCGCCCGGCCCCAATGG + Intronic
1042275768 8:67003802-67003824 GCCACCGCACCCAGCCCCAAAGG - Intronic
1042524393 8:69749330-69749352 GCCACTGCGCCCGGTGAAACAGG - Intronic
1042716892 8:71783969-71783991 GCCACCGCGCCCGGCCCATATGG - Intergenic
1042948706 8:74179552-74179574 TCCACAGCGCCCGGTCCCATCGG - Intergenic
1043431716 8:80201571-80201593 GCCACCGCGCCCGGCCGTAATGG - Intronic
1044095869 8:88063682-88063704 GCCACACCGCCAGGTGCTAATGG + Intronic
1044987904 8:97771226-97771248 GCCACTGCGCCCGGCGACTAAGG - Intergenic
1046389288 8:113547165-113547187 GCCACCGCGCCCAGCCCAAAAGG + Intergenic
1047193032 8:122695802-122695824 GCCACCGCGCCCGGCCTGAATGG + Intergenic
1047402907 8:124561143-124561165 GCCACCGCGCCCGGCCACTAGGG - Intronic
1047679328 8:127237812-127237834 GCCACTGCGCCCGGCCCAAAAGG + Intergenic
1047921534 8:129639645-129639667 GCCACCGCGCCCGGCCGCTATGG - Intergenic
1048050006 8:130807696-130807718 GCCACCGCGCCCGGCGATACTGG - Intronic
1049079569 8:140431168-140431190 GCCACCGCGCCCGGCGAGGAGGG - Intronic
1049754843 8:144306016-144306038 GCCACCGCGCCCGGCCCCTCTGG + Intronic
1049831314 8:144703003-144703025 GCCACCGTGCCCGGGGACCACGG - Intergenic
1049909553 9:252257-252279 GCCACCGTGCCCAGCCCCAAGGG + Intronic
1049914119 9:299733-299755 GCCACCGCGCCCGGCCATAATGG - Intronic
1051697126 9:19780550-19780572 GCCACCGCGCCCGGCCACACAGG + Intronic
1052451909 9:28641320-28641342 GCCACCGCGCCCGGCCTCAGAGG + Intronic
1053221739 9:36318385-36318407 ACCACCACGCCCCGTCCCAACGG - Intergenic
1053486500 9:38460747-38460769 GCCACCGCACCTGGTGAGAAAGG + Intergenic
1054776375 9:69127353-69127375 GCCACCGCGCCCGGCCGCAAGGG + Intronic
1056652806 9:88482885-88482907 GCCACTGCGCCCAGTTCGAAGGG + Intergenic
1056836517 9:89960072-89960094 GCCACCGCGCCCGGTCTTGAGGG + Intergenic
1057384933 9:94598708-94598730 GCCACTGCGCCCGGCCACAATGG + Intergenic
1057527226 9:95813574-95813596 GCCACCGCGCCCAGCCCCTAGGG + Intergenic
1057594808 9:96406712-96406734 GCCACCGTGCCCGGCCCCCACGG - Intronic
1058038892 9:100283020-100283042 GCCACCGCGCCCGGCTGAAAAGG - Intronic
1058097181 9:100875759-100875781 GCCACCGCGCCCGGCCAGAAAGG + Intergenic
1058313589 9:103535950-103535972 GCCACCGCGCCTGGCCGCAATGG - Intergenic
1059051354 9:110930228-110930250 GCCACCACGTCCGGTGGAAAGGG - Intronic
1059093943 9:111391952-111391974 GCCACCGCGCCCGGCCGGAAAGG - Intronic
1059140439 9:111847951-111847973 GCCACTGCGCCCGGCCCCAGTGG - Intergenic
1059346091 9:113629227-113629249 GCCACCGTGCCCGGCCCCTATGG - Intergenic
1059495135 9:114703082-114703104 GCCACCGCGCCCGGCCCGACAGG + Intergenic
1060590238 9:124811701-124811723 GCCACCTTGCCCGGGGCCACTGG + Exonic
1061159930 9:128887926-128887948 GCCACCGCGCCCGGCTCCCCTGG + Intronic
1061692272 9:132343031-132343053 GCCACCGCGCCCGGCAAAAAAGG - Intronic
1061787503 9:133038741-133038763 GCCACTGCGCCCGGCTCCTAGGG + Intronic
1062215857 9:135389442-135389464 GCCACGGTGCCCAGTGCCACGGG - Intergenic
1062550806 9:137085661-137085683 GCCACCGCGCCTGGCCCCAAGGG + Intergenic
1062584208 9:137241658-137241680 GTCACCGCGGCCGGTGCGCAGGG - Intronic
1185456781 X:314760-314782 GCCACCGCGCCCGGCCCCCATGG + Intronic
1186257370 X:7737112-7737134 GTCACCACGCCTGGTGCCACGGG - Intergenic
1186772336 X:12830353-12830375 GCCACCGCGCCCAGTGACACAGG + Intergenic
1186902816 X:14076058-14076080 GCCACTGCGCCCGGTGTCTATGG + Intergenic
1187479494 X:19642127-19642149 GCCACCGTGCATGGTGCTAACGG + Intronic
1187493457 X:19774383-19774405 GCCACCGCGCCCGGCGGCTTAGG - Intronic
1187713190 X:22074781-22074803 GCCACCGTGCCAGGTCCCCAAGG - Intronic
1188479381 X:30621696-30621718 GCCACCGCGCCCGGCCGCAAAGG - Intergenic
1190154815 X:47981612-47981634 GCCACCGTGCCCGGCCCCACTGG - Intronic
1190816491 X:53934346-53934368 GCCACCGCACCCGGCCCAAAGGG + Intergenic
1190869516 X:54413466-54413488 GCCACTGTGCCCGGTGACAAGGG - Intergenic
1192039846 X:67607312-67607334 GCCACCGCGCCCGGCCCACACGG + Intronic
1193510728 X:82396062-82396084 GCCACAGCGCACGGTGAGAAGGG + Intergenic
1194000789 X:88426388-88426410 GCCACCGCGCCCGGCCCAAAAGG - Intergenic
1196722546 X:118868545-118868567 GCCACCGCGCCCAGTCATAAGGG - Intergenic
1196846046 X:119897443-119897465 GCCACTGCGCCCGGCCCAAATGG + Intronic
1198800940 X:140446993-140447015 GCCACCGCGCCCAGCCCCAGTGG + Intergenic
1199353182 X:146829286-146829308 GCCACTGCACCCGGCCCCAAAGG - Intergenic
1200012182 X:153127436-153127458 GCCACCGCGCCTGGCGCCTAAGG + Intergenic
1200027418 X:153272483-153272505 GCCACCGCGCCTGGCGCCTAAGG - Intergenic
1200409948 Y:2851127-2851149 GCCACCGCGCCCGGCCCAGAGGG + Intronic
1200553137 Y:4603259-4603281 GCCACCGCGCCCGGCCCCCAGGG + Intergenic
1201704837 Y:16925134-16925156 GCCACCGCGCCGGGCCTCAAAGG + Intergenic
1201903076 Y:19063178-19063200 GCCACCGCGCCCAGCCTCAAAGG + Intergenic