ID: 1031696123

View in Genome Browser
Species Human (GRCh38)
Location 7:124857347-124857369
Sequence AATTCTACGCAGAAGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 3, 2: 56, 3: 137, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031696119_1031696123 1 Left 1031696119 7:124857323-124857345 CCAGATAGGGACAGGAGGCAGGG 0: 1
1: 1
2: 7
3: 28
4: 344
Right 1031696123 7:124857347-124857369 AATTCTACGCAGAAGAGGGCAGG 0: 1
1: 3
2: 56
3: 137
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031696123 Original CRISPR AATTCTACGCAGAAGAGGGC AGG Intronic
901549986 1:9989007-9989029 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
903601614 1:24546236-24546258 AATTCTAGGCTGAAAAGGACAGG + Intergenic
904222554 1:28984322-28984344 AATTCTAGGCAGAAAAGGACGGG - Intronic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909185667 1:72482218-72482240 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
909692687 1:78427020-78427042 AATTCTAAGCAGTAGAGGGTTGG + Intronic
909775454 1:79479037-79479059 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
910150303 1:84134354-84134376 AATTCTAGGCAGAAAAGGGCAGG - Intronic
910400216 1:86830853-86830875 AATTCTAGGCCGAGGTGGGCGGG + Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
911205774 1:95090357-95090379 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
911509192 1:98790975-98790997 AATTCTTGGCAGAAGAGAGTGGG + Intergenic
911546678 1:99225375-99225397 AATACTTGGTAGAAGAGGGCGGG - Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
913097623 1:115534546-115534568 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
914684933 1:149969996-149970018 AAATCTATTCAGAAGGGGGCTGG - Intronic
917210960 1:172631764-172631786 AATACTAGGCAGAAAAGGGTGGG + Intergenic
918038164 1:180895596-180895618 AATTCTTCACTGAAGATGGCGGG - Intergenic
918562180 1:185881631-185881653 AATTCTAGGCAGAAAAGGGTAGG - Intronic
918792548 1:188847422-188847444 AATTCTAGGCAGACAGGGGCGGG - Intergenic
918910510 1:190562629-190562651 AATTCTAGGCAGACAAGAGCAGG + Intergenic
919240782 1:194914037-194914059 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
920207233 1:204301407-204301429 ATTTCTACGCTGAATAGAGCTGG + Intronic
920291366 1:204925517-204925539 AACTCAAAGCAGAACAGGGCTGG - Intronic
921367706 1:214389446-214389468 AAATATAGACAGAAGAGGGCAGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
921674964 1:217966607-217966629 AATTCTGGGCAGAGGAGGGTGGG - Intergenic
921679970 1:218020109-218020131 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
922876400 1:228943056-228943078 AATTCTGGGCAGAAAAGGGTGGG + Intergenic
923306535 1:232693917-232693939 AATTCTGGGCAGAAGAGAGCGGG + Intergenic
923397736 1:233583852-233583874 AATTCTAGGCAGGAAAGGGCAGG + Intergenic
923701065 1:236301072-236301094 AATTCTGGGCAGAAGAGAGTGGG + Intergenic
923892883 1:238235324-238235346 AATTCTAGGTAGAAAAGGGCGGG - Intergenic
923911041 1:238444564-238444586 TATTCCAGGCAGAAAAGGGCAGG + Intergenic
923944327 1:238865313-238865335 GATTCTAGGCAGAAAAGGGTGGG - Intergenic
924356341 1:243180611-243180633 AAATCTATGTAGAAGAAGGCAGG - Intronic
924818416 1:247463376-247463398 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
924902640 1:248418072-248418094 AATTCTGGGCCGAAGAGGGTGGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064785215 10:18887661-18887683 AATACTGGGTAGAAGAGGGCGGG + Intergenic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065056925 10:21854692-21854714 GATTCAAGGCAGAAGAGAGCAGG + Intronic
1065979473 10:30878073-30878095 AATTCTAGGCAGACAGGGGCGGG + Intronic
1066281612 10:33923488-33923510 AATTCTAGGCAAAAGAGGGCGGG + Intergenic
1068681224 10:59822738-59822760 AATTCTAGGCAGAAAAGGGTAGG + Intronic
1068904476 10:62307611-62307633 AATTCTGGGCAGAAGAGGATGGG - Intergenic
1070240363 10:74674157-74674179 ATTTCTGGGCAGAAGAGGGTAGG - Intronic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1071428500 10:85583273-85583295 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1072342266 10:94464321-94464343 CATTCAACCCAAAAGAGGGCAGG - Intronic
1076432115 10:130411424-130411446 AATGCCAGGCAAAAGAGGGCAGG + Intergenic
1077778494 11:5298148-5298170 AATTTTAGGCAGAAAAGGGCGGG - Intronic
1079141006 11:17809654-17809676 AGTGGGACGCAGAAGAGGGCAGG + Intronic
1081001657 11:37680802-37680824 AACTCTGGGCAGAAGAAGGCAGG + Intergenic
1081332990 11:41826822-41826844 AATTCAAGGCAGAAAAGGGCAGG - Intergenic
1082645597 11:55720484-55720506 AATTCTAGGCAGACAAGGGCAGG - Intergenic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1084223353 11:67698525-67698547 AACTCTGTTCAGAAGAGGGCAGG - Intergenic
1085061838 11:73454523-73454545 AATTCTTAGCAGAAAAGAGCAGG + Intronic
1085870832 11:80347344-80347366 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1086286219 11:85254133-85254155 AATTGTTGGCAGAAGTGGGCAGG - Intronic
1086783003 11:90930623-90930645 AATTCTAGACAGAAAAAGGCAGG + Intergenic
1087005471 11:93466714-93466736 AATTCTAGGCAAGAAAGGGCGGG + Intergenic
1087467450 11:98526309-98526331 AATACTGTGTAGAAGAGGGCAGG - Intergenic
1087608482 11:100405726-100405748 AATTCTACGTAGAAAAGGGCAGG - Intergenic
1087698728 11:101412056-101412078 AATACTAGGCAGAAAAGGGGAGG + Intergenic
1088715383 11:112544272-112544294 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1089694648 11:120209792-120209814 AAATCTAGGCAGCAGAGAGCGGG + Intergenic
1092680129 12:10969452-10969474 AATTCTAGACAGAAAAGGGCGGG - Intronic
1092850885 12:12625231-12625253 AATTCTAGACAGAAAAGGGTGGG - Intronic
1093268437 12:17027931-17027953 AATTCTAGACAGAAGAGGGCAGG + Intergenic
1093401772 12:18754483-18754505 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1093431626 12:19091581-19091603 AATACTACACAGGAAAGGGCTGG - Intergenic
1093731291 12:22568458-22568480 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1095270132 12:40208853-40208875 TATTTTACACAGAAGTGGGCTGG + Intronic
1096170285 12:49463003-49463025 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1097661809 12:62438304-62438326 AATTCTAGCCAGCAGGGGGCAGG + Intergenic
1098936837 12:76490226-76490248 AATTCTAGGCAGAAAACGGCAGG + Intronic
1099540828 12:83905155-83905177 AATTGTAGGCAGAAAAGGGCAGG - Intergenic
1099543803 12:83950724-83950746 AATTCTGGACAGAAGAGGGCGGG + Intergenic
1100293007 12:93235436-93235458 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1100594629 12:96061248-96061270 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1100757988 12:97773361-97773383 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1101148820 12:101866300-101866322 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1101217399 12:102597600-102597622 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1101432771 12:104640818-104640840 AATTCTGGGCAGAAGAGGGTTGG + Intronic
1101473291 12:105019260-105019282 AATTCTGAGCAGAAGAGGATGGG - Intronic
1104219303 12:126766754-126766776 AATCCTAGGCAGACAAGGGCGGG + Intergenic
1104265780 12:127231445-127231467 AATTCTGGGCAGAAAAGGGCAGG + Intergenic
1105639683 13:22249648-22249670 AATTCTGGGCAGAAGAGGGTAGG + Intergenic
1105686956 13:22793351-22793373 AATTCAACCCAGAAGAGGGGTGG - Intergenic
1106870182 13:34011164-34011186 AATTCTAGGGAGAAAAGGGCGGG + Intergenic
1107217217 13:37935229-37935251 AATTCCAGGCAGAAAACGGCAGG - Intergenic
1107854092 13:44597644-44597666 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1107875124 13:44783459-44783481 AATTCTGGTCAGAAGAGGGTGGG - Intergenic
1108017028 13:46086683-46086705 GATCCTAGGCAGAAAAGGGCGGG - Intronic
1108316505 13:49242355-49242377 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1108487635 13:50942970-50942992 AATTCTGGGCAGAAGAGGGCCGG - Intronic
1108945203 13:56014586-56014608 AATTCTAGGCAGACAAGGGTAGG + Intergenic
1108958448 13:56189544-56189566 AATTCTGGCCAGAAGAGGGTAGG + Intergenic
1109419975 13:62099608-62099630 AATTCTAGGCAGAAAAGGATGGG + Intergenic
1109593778 13:64522953-64522975 AATCCTAGGCAGACAAGGGCAGG - Intergenic
1109693824 13:65927607-65927629 AATTCTAGGCAGAAAAGTGCAGG - Intergenic
1109882983 13:68506596-68506618 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1109927670 13:69167696-69167718 AATTCTAGGCCGAAAAGGGTGGG + Intergenic
1110159040 13:72353130-72353152 AATTCTAGGCAGAAAAAGGTAGG - Intergenic
1111104718 13:83629934-83629956 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1111606474 13:90546061-90546083 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113276212 13:108733664-108733686 AATATTACACAGTAGAGGGCCGG + Intronic
1114703081 14:24698119-24698141 AATTTGACCCAGAATAGGGCCGG - Intergenic
1116130831 14:40854470-40854492 AGTCCTATGCAGAAGGGGGCAGG + Intergenic
1116396485 14:44453041-44453063 AATTCTGGGCACAATAGGGCTGG - Intergenic
1116716408 14:48431753-48431775 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1117348710 14:54859615-54859637 GATTCTCAGCAGATGAGGGCAGG + Intronic
1117440906 14:55758279-55758301 AATTCTGCTCAGAAGGGGGTGGG + Intergenic
1117450616 14:55846029-55846051 AATACTACGTAGAAAAGGGTGGG - Intergenic
1118408570 14:65452005-65452027 AATTCTAGGCAGAAAATGGTGGG - Intronic
1119562619 14:75603147-75603169 AATTCTAGGCAGAAAAGGGTGGG + Intronic
1120363324 14:83533943-83533965 AAATGTAGGCAGAAGAGGACTGG - Intergenic
1121744264 14:96275673-96275695 AGTTCCACTGAGAAGAGGGCGGG + Exonic
1122643278 14:103175050-103175072 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1122915488 14:104856426-104856448 AAGCCTAGGCAGAAGAAGGCAGG + Intergenic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1123713001 15:23004206-23004228 GATTCTACACAGTACAGGGCTGG - Exonic
1123765206 15:23471165-23471187 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1124229326 15:27929113-27929135 ATTTCTACACAAAAGAGTGCTGG - Intronic
1125305845 15:38312492-38312514 AATTCTACCCACAAAAGGGGAGG - Intronic
1126018991 15:44380857-44380879 AATTAAACGCTGAAGAGGACTGG - Exonic
1126212049 15:46111145-46111167 AATTCTAGGCAGAAAAGAGTGGG + Intergenic
1126333796 15:47564656-47564678 AATTCTAGGGAGAAAAGGGCGGG + Intronic
1126654174 15:50957565-50957587 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1128870403 15:71151048-71151070 AATGCTATGGAGAAAAGGGCTGG + Intronic
1129789964 15:78334478-78334500 AGTTCTGGGCAGAAGAGGGATGG - Intergenic
1129857849 15:78837718-78837740 AATTCTCTCCTGAAGAGGGCAGG + Intronic
1130420746 15:83744902-83744924 AACTCTGGGCATAAGAGGGCGGG + Intronic
1131814744 15:96211037-96211059 AACTCTGGGCAGAAGAGGGCAGG + Intergenic
1131881483 15:96867393-96867415 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1131931554 15:97448584-97448606 AATTCTGGGCGGAAGAGGGCAGG + Intergenic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1135256978 16:20948771-20948793 AATTCCGGGCAGAAGATGGCGGG + Intronic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1137862792 16:51863620-51863642 ATTTCTGCCCAGAAGAGGGAAGG - Intergenic
1138852141 16:60641871-60641893 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1139458596 16:67104288-67104310 GATTCCACCCAGCAGAGGGCAGG + Intergenic
1140805773 16:78530703-78530725 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1140813097 16:78597043-78597065 GCTTCTACGCAGAAGAGGGTAGG - Intronic
1142301813 16:89263019-89263041 AATTCTAGGCAGACAGGGGCAGG - Intergenic
1143358323 17:6347510-6347532 AATTCTGAGAAGATGAGGGCTGG - Intergenic
1146768724 17:35548508-35548530 AATTCTGTGCAGGAGAGGGGAGG - Exonic
1147230122 17:39011651-39011673 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1147513402 17:41093649-41093671 AATTCTAGGCAGAAAAGGATAGG + Intronic
1147515492 17:41113944-41113966 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
1148537716 17:48454840-48454862 AATTCTCGGCAGAAAAGGGCAGG + Intergenic
1149237233 17:54606877-54606899 AATTATAGGCAAAAAAGGGCAGG + Intergenic
1152442643 17:80318351-80318373 AATCCTACGCAGACAGGGGCGGG - Intronic
1153703163 18:7717112-7717134 AATTCTAGGCAGAAAAGGGATGG + Intronic
1153703892 18:7725405-7725427 AATTCTGGGCAGAAAAGGACGGG + Intronic
1155017976 18:21864120-21864142 AATTCTAGGCAGACAAGGGTGGG - Intronic
1156400705 18:36736852-36736874 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1156713561 18:39977663-39977685 AATTCAAGGCAGAAAAGAGCAGG - Intergenic
1156946970 18:42844832-42844854 AATTCTAGGCAGATAGGGGCAGG - Intronic
1157102800 18:44745129-44745151 GATTCTACCCAAAAGGGGGCCGG - Intronic
1157792509 18:50545465-50545487 AATTCTAGGCAGAAAAGTGCAGG + Intergenic
1158014432 18:52766855-52766877 AATTCTAGGCAGAAAAGGGTCGG - Intronic
1158159581 18:54465704-54465726 AATTCTGGACAGAAGAGGGCAGG - Intergenic
1158968479 18:62644340-62644362 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1159030584 18:63226395-63226417 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1159564184 18:70029944-70029966 ATTTCTAGGCACAAGAGGACTGG + Intronic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1159777551 18:72620704-72620726 AATTCTAGGCAGACGAGGGTAGG - Intronic
1160292799 18:77609421-77609443 ATTTCTGGGCAGAAGGGGGCGGG + Intergenic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1165300800 19:34967533-34967555 AATTCTGGGCAGAAGAGGCCAGG + Intergenic
925320363 2:2961652-2961674 AGTTCTCCCCAGAAAAGGGCAGG - Intergenic
925984160 2:9201839-9201861 AATTATACTCAGAAGTGGGCTGG + Intergenic
926542953 2:14204266-14204288 AATTCTAGGCAGAAAAGAGCAGG + Intergenic
928813046 2:35253299-35253321 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
928860091 2:35846746-35846768 AATTCTAGGCAGAAAAGTGGCGG - Intergenic
929885966 2:45878978-45879000 AATTCTAGACGGAAAAGGGCTGG + Intronic
929906926 2:46054660-46054682 AATTCGGGGCAGAAGAGGGCAGG + Intronic
930477810 2:51906110-51906132 AATAGTAAGCAGAAGAGAGCAGG + Intergenic
930527221 2:52545328-52545350 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
931458611 2:62431861-62431883 AATTCTGGGCAGAAGTGGGTGGG + Intergenic
931462897 2:62463666-62463688 AATTCTAGGCAGAAAAGAGCGGG + Intergenic
931567200 2:63627408-63627430 AATTCTAGGCAGAAAAGGGCGGG + Intronic
931938893 2:67230560-67230582 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
933462847 2:82611821-82611843 AATACTAGGAAGAAAAGGGCAGG + Intergenic
933882268 2:86681319-86681341 AATTCTAGGCAGAAAAGAGTGGG - Intronic
935171623 2:100614795-100614817 AATGTTACCCAGAGGAGGGCGGG + Intergenic
936409451 2:112242775-112242797 AATTTTAATCAGAAGAGAGCTGG - Intronic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
936858352 2:116987044-116987066 AATTCTGGGCAGACAAGGGCGGG + Intergenic
937840342 2:126518741-126518763 AATTCTAGGCAGAAAAAGGCAGG + Intergenic
937891253 2:126940596-126940618 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
938787830 2:134648506-134648528 AATTCTGGGCAGAAGAGGGTGGG - Intronic
940418985 2:153456241-153456263 CACTCTAGGCAGAAAAGGGCGGG - Intergenic
940972555 2:159909489-159909511 GATTCAAAGCAGAAAAGGGCAGG - Intergenic
941427647 2:165368459-165368481 AATTCTGGGCAGAAGAGGACGGG - Intronic
942183894 2:173406056-173406078 AATTCAAGGCAAAACAGGGCAGG - Intergenic
943474838 2:188341136-188341158 AATTCTAGGCAGAAAAGGTCAGG - Intronic
944067455 2:195633951-195633973 AATTCTAGGCAGAAAAGGGCAGG - Intronic
944199443 2:197090585-197090607 AATTCTAGGCAGAAAAGGGCAGG + Intronic
944454472 2:199878856-199878878 AATTCTTAGCAGAAGAGGGTGGG - Intergenic
944891135 2:204118154-204118176 AATTCTAGGCAGAAAAGGAAGGG - Intergenic
946216009 2:218184092-218184114 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
948403432 2:237700938-237700960 AATTCTACACAGAAGCTGGAAGG - Intronic
1170485874 20:16816086-16816108 AATGCTACACAGGAGAGGGTGGG - Intergenic
1176695551 21:9972797-9972819 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1177124621 21:17181204-17181226 AATTCTGGGTAGAAGAGGGCAGG + Intergenic
1177281373 21:18986998-18987020 AATTCTAGGCAAAAAACGGCAGG + Intergenic
1177555065 21:22678702-22678724 AATTCTAGACAGAAAAGGGCAGG + Intergenic
1177703782 21:24674185-24674207 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1177968408 21:27758724-27758746 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178431204 21:32520245-32520267 AATTCTCTGTAGAAGAGGACAGG - Intergenic
1178447310 21:32658086-32658108 AATTCTGGGCAGAAGTGGGTGGG + Intronic
1181676122 22:24454611-24454633 ACCTCCAAGCAGAAGAGGGCAGG - Intergenic
1182690550 22:32158745-32158767 AATTTTACTGAGAAAAGGGCCGG + Intronic
1183445164 22:37848830-37848852 AATGCTACACAAAAGATGGCCGG - Intronic
949227462 3:1711545-1711567 GATTCTAGGCAGACAAGGGCAGG - Intergenic
949562203 3:5213428-5213450 AATTCTTCTCTGAAGAGGGAGGG + Exonic
949956708 3:9275060-9275082 AACTCTGGGCAGAAGAGGGCAGG - Intronic
950978857 3:17280313-17280335 AATTCTGGACAGAAGAGGGCAGG + Intronic
950997410 3:17518156-17518178 AATTCTAAGCAGAAAAGGGTGGG + Intronic
951251096 3:20395215-20395237 AATTCTGGGAAGAAGAGGGCAGG + Intergenic
951931697 3:27974270-27974292 AATTCTAGGCAGAAAAGGGAGGG - Intergenic
952109716 3:30108773-30108795 AATACTGGGTAGAAGAGGGCGGG + Intergenic
952181401 3:30920396-30920418 AATTCTAGGCAGACAGGGGCAGG + Intergenic
954563594 3:51579401-51579423 AATTCTGGGCAGAAGAGGGCAGG - Intronic
955365528 3:58306912-58306934 AATGCTACGAAGAAGAAAGCAGG + Intronic
955950416 3:64237727-64237749 AATACTAGGCAGAAAAGGGTGGG - Intronic
956930246 3:74035178-74035200 AATTCAAAGCAGAAGAGAGTAGG + Intergenic
956932551 3:74061361-74061383 AATTTTACTCTGAAGAGGACAGG + Intergenic
957244652 3:77702065-77702087 AATACTAGGCAGAAAAGGGTGGG + Intergenic
957414184 3:79879017-79879039 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
958119337 3:89263847-89263869 AATTCTAGGAAGAAAAGGGAGGG - Intronic
958467387 3:94474022-94474044 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
959155647 3:102663715-102663737 AATACTAGGTAGAAAAGGGCAGG + Intergenic
960172432 3:114477800-114477822 AAGTCTATGCAAAAGAGTGCAGG - Intronic
960938411 3:122917577-122917599 AATTATACAAAGAAGAGGGTGGG + Intronic
963409669 3:144911514-144911536 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
963410618 3:144922389-144922411 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
963774809 3:149427966-149427988 AATTCTATATAGAAGATGGCAGG - Intergenic
963858378 3:150280383-150280405 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966059182 3:175734256-175734278 AAATCTAGGCAGAGGTGGGCTGG + Intronic
967627891 3:191707833-191707855 AATTCTAGCCAGCAAAGGGCAGG + Intergenic
968544176 4:1188499-1188521 AATAGTAAGCAGAAGAGAGCTGG + Intronic
969114788 4:4864801-4864823 AATTCCACGCAGGATAGCGCCGG + Intergenic
970131599 4:12877152-12877174 AATTCTAGGCAGAAAAAGGCAGG - Intergenic
971427422 4:26530226-26530248 AGTTCTGGGCAGACGAGGGCAGG + Intergenic
972066488 4:34952830-34952852 AATTCTAGGCAGACAAGGGCAGG + Intergenic
973022504 4:45220792-45220814 AATTCTAGGCAGACAGGGGCAGG - Intergenic
973954719 4:56050736-56050758 ACTTCAACTCAGAAGTGGGCAGG + Intergenic
974505850 4:62771606-62771628 AATTCTAGTCAGAAAAGGGTAGG + Intergenic
974772631 4:66435497-66435519 AATTCAAAGCAAAAAAGGGCTGG - Intergenic
975387091 4:73770321-73770343 AATTCTAGGTAAAAAAGGGCAGG + Intergenic
975947430 4:79724320-79724342 AATTCTATGCAGAAAAGGGCGGG - Intergenic
976031411 4:80758566-80758588 AATTCTGGGCAGAAGAGAGTGGG - Intronic
976042092 4:80898601-80898623 AATTCTGGGAAGAAGAGGGTGGG - Intronic
977338757 4:95730420-95730442 AATTCTAGGCATAAAAGGGCAGG - Intergenic
977364910 4:96056018-96056040 AATTCTAGGTAGAAAAGTGCAGG + Intergenic
977672845 4:99716015-99716037 AATTTTGGGCAGAAGGGGGCAGG + Intergenic
977781396 4:100985703-100985725 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
977827549 4:101551698-101551720 AATTCTGGGCAGAAGAGGGCAGG + Intronic
978384424 4:108166742-108166764 AAATCTACGCAGAAGAAAGGCGG - Intronic
978593833 4:110355775-110355797 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979596565 4:122541472-122541494 AATTCTGTGCAGAAGAGGGTGGG + Intergenic
979946759 4:126842862-126842884 AATTCTAGGCAGATAGGGGCAGG + Intergenic
980368177 4:131833045-131833067 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
980492982 4:133553135-133553157 AATTCTAGGCAGAAAAGGCAGGG - Intergenic
980495395 4:133584059-133584081 AATTCTGGGCAGAAGAGGATGGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
981729142 4:147879068-147879090 AGTTCTAAGAAGAAGAGGGGAGG - Intronic
981978502 4:150761816-150761838 AATTCTATTCAGAAGAATGCAGG - Exonic
982786678 4:159544392-159544414 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
982798536 4:159673797-159673819 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
983462700 4:168047432-168047454 AATTCCAGGCAGAAAAGGGCAGG - Intergenic
983697927 4:170554989-170555011 AATTCTAGGCAGACAGGGGCAGG - Intergenic
983987233 4:174073868-174073890 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
984129602 4:175857009-175857031 AATACTGGGTAGAAGAGGGCAGG - Intronic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
986286358 5:6361986-6362008 AGTGCCAAGCAGAAGAGGGCAGG + Intergenic
986292615 5:6412106-6412128 AATTCTACCCAGAAGAGAATGGG - Intergenic
987268222 5:16278357-16278379 AATACTGGGTAGAAGAGGGCCGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
988231413 5:28484152-28484174 AATTCTGGGCAGAAGAGAGTGGG - Intergenic
988350861 5:30106028-30106050 AATTCTGGGCTGAAGAGGGCAGG + Intergenic
988635345 5:32977798-32977820 AATACTGGGTAGAAGAGGGCAGG + Intergenic
989193574 5:38694220-38694242 CAATCTACGAAGGAGAGGGCTGG + Intergenic
990176597 5:53114809-53114831 AATTTTAGGCAGAAAAGGGAGGG - Intergenic
990293402 5:54378139-54378161 AATTCTAGGCAGACAGGGGCAGG + Intergenic
990463083 5:56047620-56047642 AATACTGGGTAGAAGAGGGCAGG + Intergenic
990814419 5:59767661-59767683 AATTCTACGCAGAAAGTTGCAGG - Intronic
991219633 5:64198567-64198589 AATTTCAGGGAGAAGAGGGCAGG + Intronic
993088160 5:83390400-83390422 AATTCAACTCAGTAGAGGCCTGG + Intergenic
993204224 5:84860129-84860151 AATTCAATGCAAAAGAAGGCAGG + Intergenic
994188135 5:96838174-96838196 AATTCTGGGCAGAAGAGGGCAGG - Intronic
994775215 5:104031016-104031038 AATTCTAGGCAGAAAAGGAAAGG + Intergenic
994830479 5:104775222-104775244 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
996101565 5:119450323-119450345 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
996242010 5:121215596-121215618 AATACTGGGTAGAAGAGGGCAGG + Intergenic
996502207 5:124229958-124229980 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
996650808 5:125873713-125873735 AATTCTGGGCAGAAGAAGGTGGG - Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998644040 5:144042525-144042547 AATTCTGGGCAGAAGAGGGAGGG - Intergenic
999851177 5:155541365-155541387 AATTCTAGGCAGAAGAGGACGGG + Intergenic
1000233401 5:159335966-159335988 AATTCTAGGCAGAAAAGAGTGGG + Intergenic
1000234504 5:159344889-159344911 AATACTGGGTAGAAGAGGGCAGG - Intergenic
1000845915 5:166280261-166280283 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
1001969633 5:175944112-175944134 AATTCCAGGCAGAAAAGGGCAGG - Intronic
1002247801 5:177899641-177899663 AATTCCAGGCAGAAAAGGGCAGG + Intergenic
1002457378 5:179353284-179353306 CCTTCTCCTCAGAAGAGGGCTGG - Intergenic
1004495192 6:16156307-16156329 AATTCTGGGCAGAAGAGGTCGGG - Intergenic
1004977564 6:20984935-20984957 AATTCTGGGTAGAAAAGGGCAGG - Intronic
1006457052 6:34137890-34137912 TATTATACTAAGAAGAGGGCCGG - Intronic
1007236427 6:40393902-40393924 GAGTCTAAGCAGAAGAGGACTGG + Intronic
1007931985 6:45700019-45700041 AATACTGGGCAGAAGAGGGCAGG + Intergenic
1008037742 6:46763720-46763742 AATGCTACGCAGAAGAGCCCTGG - Intergenic
1008108559 6:47467335-47467357 AATTCCACACAGAAGAAGGTTGG + Intergenic
1008215535 6:48783248-48783270 AATTCTAGGCAGAAAAAGGTGGG - Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1009524723 6:64729203-64729225 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1009936654 6:70242186-70242208 TATTCTCAGGAGAAGAGGGCGGG + Intronic
1010346438 6:74815893-74815915 AATTCTGAGCGGAAGAGGGTGGG - Intergenic
1010584540 6:77642120-77642142 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1010736547 6:79450343-79450365 AATTCTAGGAAGAAAAGGGCAGG + Intergenic
1011493466 6:87916208-87916230 AATTCTGGGCAGGAAAGGGCGGG + Intergenic
1011547456 6:88497081-88497103 AATTCTACCCAGAATAGAACAGG + Intergenic
1011899590 6:92275431-92275453 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1012843121 6:104355677-104355699 AATTCTAGGCAGAAAAGTGTGGG + Intergenic
1013492396 6:110660931-110660953 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1014252267 6:119127177-119127199 AATTCTAGGCATAAAAGGGTGGG - Intronic
1016028086 6:139309229-139309251 AAATCTAAGCAGAAGAGTCCTGG - Intergenic
1016546969 6:145234799-145234821 CATTCTAAGCATAAGAGGCCTGG - Intergenic
1016549009 6:145255870-145255892 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1017584804 6:155909063-155909085 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1018097892 6:160408484-160408506 TATTGTACCCAGAAGAGTGCTGG + Intronic
1019033078 6:169030408-169030430 ACTTCGACGGAGAAGAGAGCAGG + Intergenic
1019042263 6:169117148-169117170 AATTCTAGGCAGAAAAGGACAGG + Intergenic
1019043405 6:169124717-169124739 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020284169 7:6667496-6667518 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
1020382514 7:7562505-7562527 AATTATAAGCAAAACAGGGCTGG - Intergenic
1020564609 7:9779222-9779244 AATTCCACGCATAAAAGGGTGGG - Intergenic
1020739133 7:11990702-11990724 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1021158458 7:17241627-17241649 TAAACTACGCAGAAGAGGTCAGG + Intergenic
1022117222 7:27272597-27272619 AATACTAATCAAAAGAGGGCTGG - Intergenic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1022563037 7:31369619-31369641 AGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1022591758 7:31670680-31670702 AATTCTGGGCAGAAGAGAGCAGG + Intergenic
1022679678 7:32532430-32532452 TATTCTAGGCAGAAAAGGGTGGG - Intronic
1024808914 7:53184281-53184303 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1025060285 7:55799569-55799591 AATTATAGGCAAAAGAGGACAGG + Intronic
1025193695 7:56916035-56916057 AATTCTACCCAGCCCAGGGCCGG - Intergenic
1025678248 7:63660905-63660927 AATTCTACCCAGCCCAGGGCCGG + Intergenic
1025925523 7:65956727-65956749 GATTCTGCCCAGAAGAGGGGGGG + Intronic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026280963 7:68921498-68921520 AATTCTAGGCAGAAGAGGGTGGG + Intergenic
1026919449 7:74144463-74144485 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1028297991 7:89159490-89159512 AATGCTACAGAGAAGAGAGCAGG + Intronic
1028501192 7:91520648-91520670 AATTCTGGGAAGAAGAGGGTGGG + Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029671763 7:102037646-102037668 AATTCTACCCAGCCCAGGGCCGG - Intronic
1030546933 7:110907615-110907637 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1031063472 7:117077355-117077377 AATTCTAGACAGAAAAGGGCAGG - Intronic
1031116336 7:117673038-117673060 AATTCTAGGCAGAAAAGGGCGGG + Intronic
1031696123 7:124857347-124857369 AATTCTACGCAGAAGAGGGCAGG + Intronic
1032248426 7:130232432-130232454 AATTCTGGGCAGAAAAGGGCAGG - Intergenic
1032797591 7:135290207-135290229 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1032917639 7:136510170-136510192 AATTCTAGGCAGAAAAGGATGGG - Intergenic
1034093036 7:148381742-148381764 AAATCTAGGCAGAAAGGGGCGGG - Intronic
1037258489 8:16981609-16981631 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1037427447 8:18771292-18771314 AATTCTGGGCAGAAGAGGATGGG - Intronic
1037904949 8:22710785-22710807 AATTAAAAGCAGAAGAGGGGAGG + Intergenic
1038369114 8:26970042-26970064 AATTATGGGCAGAAGAGGGTGGG - Intergenic
1039645567 8:39278395-39278417 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1039661305 8:39470506-39470528 AATCCTAGGCAGAAGAGGGTGGG + Intergenic
1039679129 8:39709528-39709550 AATTTTAGGCAGAAAAAGGCAGG - Intronic
1040908349 8:52491876-52491898 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1042004359 8:64165247-64165269 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1042081517 8:65059582-65059604 AATCCTAGGCAGAAAAGGGAGGG + Intergenic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1043701397 8:83292234-83292256 AATTCTAGGCACAAAAGGGCAGG - Intergenic
1044274724 8:90286028-90286050 AACTCTGGGCAGAAGAGGCCAGG - Intergenic
1044286876 8:90420098-90420120 AATTCTGGGCAGAAGAGTGTGGG - Intergenic
1045762592 8:105628411-105628433 AATTCTAGGCAGAAAAGGGTGGG + Intronic
1046080367 8:109363135-109363157 AGTAATACCCAGAAGAGGGCTGG + Intronic
1046209613 8:111052241-111052263 AATTCTACTCAAAAGAATGCTGG - Intergenic
1048006297 8:130422058-130422080 AATTCTACCCAGAATCAGGCTGG + Intronic
1048800351 8:138188928-138188950 AATTCTGGGCAGAAGAGGGAAGG + Intronic
1050819222 9:9856401-9856423 AATTCTAGGCAGAAAAGGATGGG - Intronic
1050944348 9:11499028-11499050 AATTCTGGGCAGAAGAGGACAGG + Intergenic
1050990848 9:12149700-12149722 AATTCTGGGCAGAAGAGAGTAGG - Intergenic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1052518746 9:29515155-29515177 CGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1052540487 9:29805000-29805022 AATTCAGGGCAGAAAAGGGCAGG - Intergenic
1052593706 9:30531561-30531583 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1053545418 9:39018138-39018160 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1053632534 9:39958748-39958770 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1053773226 9:41504783-41504805 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1053809748 9:41839836-41839858 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054211354 9:62291949-62291971 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1054313629 9:63556903-63556925 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1054620845 9:67347592-67347614 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1055240831 9:74183700-74183722 AGTTCTCAGCAGAAGAGGGCAGG - Intergenic
1055375519 9:75645490-75645512 ATTTCTAGGCAGAAAAGGGTGGG - Intergenic
1055376171 9:75649750-75649772 TATTCTAGGCAGAAAAGGGTGGG - Intergenic
1056427067 9:86488212-86488234 AACTCTGGGCAGAAGAGGGTGGG + Intergenic
1057147549 9:92768398-92768420 AATTCCAGGTAGAAAAGGGCGGG - Intergenic
1058485949 9:105443619-105443641 GATTTTACTCAGAAAAGGGCAGG + Intergenic
1059586322 9:115611176-115611198 AATTCTCCCCAGAAGAGGAAAGG - Intergenic
1185983472 X:4805267-4805289 AATTATCCTCAGAAGTGGGCTGG + Intergenic
1186033268 X:5392613-5392635 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1186087095 X:6002626-6002648 AATTCTGGGCAGAAGAGAGCGGG + Intronic
1186127157 X:6426333-6426355 AATTCTGGGCAGAAAAGGGAGGG - Intergenic
1186128674 X:6443089-6443111 AATTCTGGGCAGAAGAGGGCGGG - Intergenic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1188116743 X:26254124-26254146 AATTCTGGGCAGAAGAGTGTAGG + Intergenic
1188125510 X:26363425-26363447 AATTCTGGTCATAAGAGGGCAGG - Intergenic
1188182350 X:27072261-27072283 AATTCTGGGCACAAGAGGGCAGG + Intergenic
1188527060 X:31098085-31098107 AATTCTAGGCAGACAAGGGTGGG - Intronic
1188553206 X:31383503-31383525 AATTCTGGACAGAAGAGGGCGGG + Intronic
1188554841 X:31399566-31399588 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1189675086 X:43453179-43453201 AATTCTGGGCAGAAGAGGATGGG - Intergenic
1189927105 X:45967318-45967340 AATACTAACCAGAAGAGAGCGGG - Intergenic
1190512468 X:51187063-51187085 AATTTTAAGCAAAAGAGAGCAGG + Intergenic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1191767166 X:64710347-64710369 AATACTAGGTAGAAAAGGGCAGG - Intergenic
1193747683 X:85301708-85301730 TATTTTACACAGAAGAAGGCAGG + Intronic
1193809926 X:86039595-86039617 AATTCTAGGCAGAAAAGGGCAGG + Intronic
1194176257 X:90651714-90651736 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1194690706 X:96980601-96980623 AGCTCTAGGCAGAAAAGGGCAGG - Intronic
1194878902 X:99225636-99225658 AATTCCTGGCAGAAGAGGGCAGG + Intergenic
1195721346 X:107871994-107872016 AATTCTGGGCAGAAGAGGATAGG - Intronic
1195722510 X:107879678-107879700 AATTCTGGGCAGAAGAGAGTGGG - Intronic
1195858711 X:109358195-109358217 AATTCTAGACAGAAAAGGGAGGG + Intergenic
1196300713 X:114047411-114047433 AATTTTGGGCAGAAGAGGGCAGG + Intergenic
1196395962 X:115261814-115261836 AATTCTGGGCAGAAGAGAGCAGG - Intergenic
1197340751 X:125263641-125263663 AATTCTAGGCAGAAAAGGATGGG - Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1199219947 X:145306252-145306274 AATTCTAGGCAGAAAATGGTGGG - Intergenic
1199336996 X:146630165-146630187 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1200522882 Y:4232659-4232681 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1201639109 Y:16159966-16159988 AATTCTGGGTAGAAGAGGGTGGG + Intergenic
1201663704 Y:16425361-16425383 AATTCTGGGTAGAAGAGGGTGGG - Intergenic