ID: 1031707874

View in Genome Browser
Species Human (GRCh38)
Location 7:125004658-125004680
Sequence GACTAGTATCTTAAACTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031707873_1031707874 -7 Left 1031707873 7:125004642-125004664 CCTGCTTGATTTAGTGGACTAGT No data
Right 1031707874 7:125004658-125004680 GACTAGTATCTTAAACTGCTTGG No data
1031707871_1031707874 4 Left 1031707871 7:125004631-125004653 CCAAAGAAGTGCCTGCTTGATTT No data
Right 1031707874 7:125004658-125004680 GACTAGTATCTTAAACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031707874 Original CRISPR GACTAGTATCTTAAACTGCT TGG Intergenic
No off target data available for this crispr