ID: 1031710361

View in Genome Browser
Species Human (GRCh38)
Location 7:125037369-125037391
Sequence CTAGTTTACCACTTATCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031710357_1031710361 27 Left 1031710357 7:125037319-125037341 CCAAGGTCACACAGTAAGTGACA No data
Right 1031710361 7:125037369-125037391 CTAGTTTACCACTTATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031710361 Original CRISPR CTAGTTTACCACTTATCTGT AGG Intergenic
No off target data available for this crispr