ID: 1031713182

View in Genome Browser
Species Human (GRCh38)
Location 7:125075107-125075129
Sequence TTTGACATGAGATTTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32547
Summary {0: 407, 1: 1393, 2: 3754, 3: 12478, 4: 14515}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031713182_1031713195 16 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713195 7:125075146-125075168 TGAAAAGGGGGCCTGGTGGGAGG No data
1031713182_1031713193 12 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713193 7:125075142-125075164 GTGTTGAAAAGGGGGCCTGGTGG No data
1031713182_1031713190 4 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713190 7:125075134-125075156 AATCTCCAGTGTTGAAAAGGGGG No data
1031713182_1031713194 13 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713194 7:125075143-125075165 TGTTGAAAAGGGGGCCTGGTGGG No data
1031713182_1031713198 30 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713198 7:125075160-125075182 GGTGGGAGGAAATTGGATCATGG No data
1031713182_1031713187 1 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713187 7:125075131-125075153 TATAATCTCCAGTGTTGAAAAGG No data
1031713182_1031713188 2 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713188 7:125075132-125075154 ATAATCTCCAGTGTTGAAAAGGG No data
1031713182_1031713196 23 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713196 7:125075153-125075175 GGGGCCTGGTGGGAGGAAATTGG No data
1031713182_1031713189 3 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713189 7:125075133-125075155 TAATCTCCAGTGTTGAAAAGGGG No data
1031713182_1031713192 9 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031713182 Original CRISPR TTTGACATGAGATTTGGGTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr