ID: 1031713183

View in Genome Browser
Species Human (GRCh38)
Location 7:125075108-125075130
Sequence ATTTGACATGAGATTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32338
Summary {0: 415, 1: 1612, 2: 3815, 3: 12769, 4: 13727}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031713183_1031713188 1 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713188 7:125075132-125075154 ATAATCTCCAGTGTTGAAAAGGG No data
1031713183_1031713193 11 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713193 7:125075142-125075164 GTGTTGAAAAGGGGGCCTGGTGG No data
1031713183_1031713190 3 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713190 7:125075134-125075156 AATCTCCAGTGTTGAAAAGGGGG No data
1031713183_1031713199 30 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713199 7:125075161-125075183 GTGGGAGGAAATTGGATCATGGG No data
1031713183_1031713198 29 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713198 7:125075160-125075182 GGTGGGAGGAAATTGGATCATGG No data
1031713183_1031713187 0 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713187 7:125075131-125075153 TATAATCTCCAGTGTTGAAAAGG No data
1031713183_1031713192 8 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG No data
1031713183_1031713195 15 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713195 7:125075146-125075168 TGAAAAGGGGGCCTGGTGGGAGG No data
1031713183_1031713189 2 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713189 7:125075133-125075155 TAATCTCCAGTGTTGAAAAGGGG No data
1031713183_1031713194 12 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713194 7:125075143-125075165 TGTTGAAAAGGGGGCCTGGTGGG No data
1031713183_1031713196 22 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713196 7:125075153-125075175 GGGGCCTGGTGGGAGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031713183 Original CRISPR ATTTGACATGAGATTTGGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr