ID: 1031713185

View in Genome Browser
Species Human (GRCh38)
Location 7:125075112-125075134
Sequence TATAATTTGACATGAGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21943
Summary {0: 65, 1: 877, 2: 2225, 3: 5231, 4: 13545}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031713185_1031713190 -1 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713190 7:125075134-125075156 AATCTCCAGTGTTGAAAAGGGGG No data
1031713185_1031713195 11 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713195 7:125075146-125075168 TGAAAAGGGGGCCTGGTGGGAGG No data
1031713185_1031713193 7 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713193 7:125075142-125075164 GTGTTGAAAAGGGGGCCTGGTGG No data
1031713185_1031713198 25 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713198 7:125075160-125075182 GGTGGGAGGAAATTGGATCATGG No data
1031713185_1031713199 26 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713199 7:125075161-125075183 GTGGGAGGAAATTGGATCATGGG No data
1031713185_1031713187 -4 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713187 7:125075131-125075153 TATAATCTCCAGTGTTGAAAAGG No data
1031713185_1031713192 4 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG No data
1031713185_1031713188 -3 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713188 7:125075132-125075154 ATAATCTCCAGTGTTGAAAAGGG No data
1031713185_1031713189 -2 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713189 7:125075133-125075155 TAATCTCCAGTGTTGAAAAGGGG No data
1031713185_1031713194 8 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713194 7:125075143-125075165 TGTTGAAAAGGGGGCCTGGTGGG No data
1031713185_1031713196 18 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713196 7:125075153-125075175 GGGGCCTGGTGGGAGGAAATTGG No data
1031713185_1031713200 27 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713200 7:125075162-125075184 TGGGAGGAAATTGGATCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031713185 Original CRISPR TATAATTTGACATGAGATTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr