ID: 1031713192

View in Genome Browser
Species Human (GRCh38)
Location 7:125075139-125075161
Sequence CCAGTGTTGAAAAGGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031713184_1031713192 7 Left 1031713184 7:125075109-125075131 CCACCCAAATCTCATGTCAAATT 0: 463
1: 1544
2: 3750
3: 12757
4: 15159
Right 1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG No data
1031713186_1031713192 3 Left 1031713186 7:125075113-125075135 CCAAATCTCATGTCAAATTATAA 0: 70
1: 970
2: 2325
3: 4808
4: 9310
Right 1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG No data
1031713185_1031713192 4 Left 1031713185 7:125075112-125075134 CCCAAATCTCATGTCAAATTATA 0: 65
1: 877
2: 2225
3: 5231
4: 13545
Right 1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG No data
1031713183_1031713192 8 Left 1031713183 7:125075108-125075130 CCCACCCAAATCTCATGTCAAAT 0: 415
1: 1612
2: 3815
3: 12769
4: 13727
Right 1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG No data
1031713182_1031713192 9 Left 1031713182 7:125075107-125075129 CCCCACCCAAATCTCATGTCAAA 0: 407
1: 1393
2: 3754
3: 12478
4: 14515
Right 1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031713192 Original CRISPR CCAGTGTTGAAAAGGGGGCC TGG Intergenic
No off target data available for this crispr