ID: 1031721809

View in Genome Browser
Species Human (GRCh38)
Location 7:125186645-125186667
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031721802_1031721809 24 Left 1031721802 7:125186598-125186620 CCGGCAGAGGCCATGTGGCACAG No data
Right 1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG No data
1031721803_1031721809 14 Left 1031721803 7:125186608-125186630 CCATGTGGCACAGAGAGAGAATC No data
Right 1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031721809 Original CRISPR AGAGAGAGCACAGTGATTGT GGG Intergenic