ID: 1031722622

View in Genome Browser
Species Human (GRCh38)
Location 7:125194816-125194838
Sequence TCACAAGCATAGTGTCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031722621_1031722622 19 Left 1031722621 7:125194774-125194796 CCTCTTTATAAATTAATCAGTCT No data
Right 1031722622 7:125194816-125194838 TCACAAGCATAGTGTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031722622 Original CRISPR TCACAAGCATAGTGTCTGAA AGG Intergenic
No off target data available for this crispr