ID: 1031723634

View in Genome Browser
Species Human (GRCh38)
Location 7:125208780-125208802
Sequence CTTTATGTCCATGTGTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031723634_1031723640 12 Left 1031723634 7:125208780-125208802 CCAAGTAACACATGGACATAAAG No data
Right 1031723640 7:125208815-125208837 CCGTATATTCAGAAGGTTGGGGG No data
1031723634_1031723642 22 Left 1031723634 7:125208780-125208802 CCAAGTAACACATGGACATAAAG No data
Right 1031723642 7:125208825-125208847 AGAAGGTTGGGGGTCTGTGAGGG No data
1031723634_1031723638 11 Left 1031723634 7:125208780-125208802 CCAAGTAACACATGGACATAAAG No data
Right 1031723638 7:125208814-125208836 ACCGTATATTCAGAAGGTTGGGG No data
1031723634_1031723641 21 Left 1031723634 7:125208780-125208802 CCAAGTAACACATGGACATAAAG No data
Right 1031723641 7:125208824-125208846 CAGAAGGTTGGGGGTCTGTGAGG No data
1031723634_1031723637 10 Left 1031723634 7:125208780-125208802 CCAAGTAACACATGGACATAAAG No data
Right 1031723637 7:125208813-125208835 TACCGTATATTCAGAAGGTTGGG No data
1031723634_1031723636 9 Left 1031723634 7:125208780-125208802 CCAAGTAACACATGGACATAAAG No data
Right 1031723636 7:125208812-125208834 ATACCGTATATTCAGAAGGTTGG No data
1031723634_1031723635 5 Left 1031723634 7:125208780-125208802 CCAAGTAACACATGGACATAAAG No data
Right 1031723635 7:125208808-125208830 AATGATACCGTATATTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031723634 Original CRISPR CTTTATGTCCATGTGTTACT TGG (reversed) Intergenic
No off target data available for this crispr