ID: 1031723640

View in Genome Browser
Species Human (GRCh38)
Location 7:125208815-125208837
Sequence CCGTATATTCAGAAGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031723634_1031723640 12 Left 1031723634 7:125208780-125208802 CCAAGTAACACATGGACATAAAG No data
Right 1031723640 7:125208815-125208837 CCGTATATTCAGAAGGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031723640 Original CRISPR CCGTATATTCAGAAGGTTGG GGG Intergenic
No off target data available for this crispr