ID: 1031723956

View in Genome Browser
Species Human (GRCh38)
Location 7:125212791-125212813
Sequence CTGCATCAATAGAAGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031723953_1031723956 15 Left 1031723953 7:125212753-125212775 CCACAAACTTTTATGGTGGGACC No data
Right 1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG No data
1031723952_1031723956 16 Left 1031723952 7:125212752-125212774 CCCACAAACTTTTATGGTGGGAC No data
Right 1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG No data
1031723948_1031723956 28 Left 1031723948 7:125212740-125212762 CCAGCTCATTCACCCACAAACTT No data
Right 1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG No data
1031723954_1031723956 -6 Left 1031723954 7:125212774-125212796 CCAGTATTAGCAGACTGCTGCAT No data
Right 1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031723956 Original CRISPR CTGCATCAATAGAAGGAGCT TGG Intergenic
No off target data available for this crispr