ID: 1031732541

View in Genome Browser
Species Human (GRCh38)
Location 7:125316384-125316406
Sequence AGGGAGAGTACAGAGATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031732533_1031732541 24 Left 1031732533 7:125316337-125316359 CCATTCCCTGGCAATGGCATGGT No data
Right 1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG No data
1031732535_1031732541 18 Left 1031732535 7:125316343-125316365 CCTGGCAATGGCATGGTGTGAAG No data
Right 1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG No data
1031732531_1031732541 25 Left 1031732531 7:125316336-125316358 CCCATTCCCTGGCAATGGCATGG No data
Right 1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG No data
1031732534_1031732541 19 Left 1031732534 7:125316342-125316364 CCCTGGCAATGGCATGGTGTGAA No data
Right 1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031732541 Original CRISPR AGGGAGAGTACAGAGATTTT GGG Intergenic
No off target data available for this crispr