ID: 1031732729

View in Genome Browser
Species Human (GRCh38)
Location 7:125318399-125318421
Sequence AGTTCTAGGCTGGGATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031732724_1031732729 28 Left 1031732724 7:125318348-125318370 CCTCTTAATTCATCAGACCTGTA No data
Right 1031732729 7:125318399-125318421 AGTTCTAGGCTGGGATCTCAAGG No data
1031732725_1031732729 11 Left 1031732725 7:125318365-125318387 CCTGTAAAAACTAAAAGCATGTT No data
Right 1031732729 7:125318399-125318421 AGTTCTAGGCTGGGATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031732729 Original CRISPR AGTTCTAGGCTGGGATCTCA AGG Intergenic
No off target data available for this crispr