ID: 1031736656

View in Genome Browser
Species Human (GRCh38)
Location 7:125371864-125371886
Sequence CTCTTGATTAAAAGCAACAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031736656_1031736660 17 Left 1031736656 7:125371864-125371886 CCGTTGTTGCTTTTAATCAAGAG No data
Right 1031736660 7:125371904-125371926 GATCGTTTGTCCAAACAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031736656 Original CRISPR CTCTTGATTAAAAGCAACAA CGG (reversed) Intergenic
No off target data available for this crispr