ID: 1031737832

View in Genome Browser
Species Human (GRCh38)
Location 7:125389051-125389073
Sequence CTGAGTCAGAGGCAAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031737832_1031737842 24 Left 1031737832 7:125389051-125389073 CCTTCTCCTTGCCTCTGACTCAG No data
Right 1031737842 7:125389098-125389120 CCTAAGCTATGTGTAGCGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031737832 Original CRISPR CTGAGTCAGAGGCAAGGAGA AGG (reversed) Intergenic
No off target data available for this crispr