ID: 1031741426

View in Genome Browser
Species Human (GRCh38)
Location 7:125436470-125436492
Sequence AAGTATGCACAGAGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031741420_1031741426 27 Left 1031741420 7:125436420-125436442 CCTGAAGGCTGCACTGTGGTACT No data
Right 1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG No data
1031741419_1031741426 28 Left 1031741419 7:125436419-125436441 CCCTGAAGGCTGCACTGTGGTAC No data
Right 1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG No data
1031741421_1031741426 3 Left 1031741421 7:125436444-125436466 CCAGTTTCAAGTGAACAATCCAG No data
Right 1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031741426 Original CRISPR AAGTATGCACAGAGGAAGCT GGG Intergenic
No off target data available for this crispr