ID: 1031742511

View in Genome Browser
Species Human (GRCh38)
Location 7:125452683-125452705
Sequence GTATCCTCCTAGAACAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031742509_1031742511 18 Left 1031742509 7:125452642-125452664 CCTCTTTTATTCTAAATCATGGA No data
Right 1031742511 7:125452683-125452705 GTATCCTCCTAGAACAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031742511 Original CRISPR GTATCCTCCTAGAACAGTGA AGG Intergenic
No off target data available for this crispr