ID: 1031743845

View in Genome Browser
Species Human (GRCh38)
Location 7:125468638-125468660
Sequence CTCCTGACTGCTCCGTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031743836_1031743845 16 Left 1031743836 7:125468599-125468621 CCTGTGTCTGCAGCCCAGGTTTG No data
Right 1031743845 7:125468638-125468660 CTCCTGACTGCTCCGTGAAGTGG No data
1031743841_1031743845 3 Left 1031743841 7:125468612-125468634 CCCAGGTTTGGGTGGCTGGAACA No data
Right 1031743845 7:125468638-125468660 CTCCTGACTGCTCCGTGAAGTGG No data
1031743842_1031743845 2 Left 1031743842 7:125468613-125468635 CCAGGTTTGGGTGGCTGGAACAG No data
Right 1031743845 7:125468638-125468660 CTCCTGACTGCTCCGTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031743845 Original CRISPR CTCCTGACTGCTCCGTGAAG TGG Intergenic
No off target data available for this crispr