ID: 1031745733

View in Genome Browser
Species Human (GRCh38)
Location 7:125495533-125495555
Sequence AGGGAGGTGCAGAATTACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031745733_1031745739 0 Left 1031745733 7:125495533-125495555 CCCTCGTAATTCTGCACCTCCCT No data
Right 1031745739 7:125495556-125495578 GTATAGCAGGTGTTCTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031745733 Original CRISPR AGGGAGGTGCAGAATTACGA GGG (reversed) Intergenic
No off target data available for this crispr