ID: 1031750361

View in Genome Browser
Species Human (GRCh38)
Location 7:125563890-125563912
Sequence GCCACTGAGCAGCCAACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031750352_1031750361 21 Left 1031750352 7:125563846-125563868 CCAAGGGGAATTCGGCCAAGGGT No data
Right 1031750361 7:125563890-125563912 GCCACTGAGCAGCCAACCCCAGG No data
1031750357_1031750361 6 Left 1031750357 7:125563861-125563883 CCAAGGGTGGGTGGTCTGAGGAG No data
Right 1031750361 7:125563890-125563912 GCCACTGAGCAGCCAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031750361 Original CRISPR GCCACTGAGCAGCCAACCCC AGG Intergenic
No off target data available for this crispr