ID: 1031752453

View in Genome Browser
Species Human (GRCh38)
Location 7:125593709-125593731
Sequence CTGCCTAGGACTTTGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031752453_1031752460 4 Left 1031752453 7:125593709-125593731 CCACCTCCCAAAGTCCTAGGCAG No data
Right 1031752460 7:125593736-125593758 GGTCTAAGGACTAGAACTTCAGG No data
1031752453_1031752458 -10 Left 1031752453 7:125593709-125593731 CCACCTCCCAAAGTCCTAGGCAG No data
Right 1031752458 7:125593722-125593744 TCCTAGGCAGACAAGGTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031752453 Original CRISPR CTGCCTAGGACTTTGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr