ID: 1031752460

View in Genome Browser
Species Human (GRCh38)
Location 7:125593736-125593758
Sequence GGTCTAAGGACTAGAACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031752454_1031752460 1 Left 1031752454 7:125593712-125593734 CCTCCCAAAGTCCTAGGCAGACA No data
Right 1031752460 7:125593736-125593758 GGTCTAAGGACTAGAACTTCAGG No data
1031752457_1031752460 -3 Left 1031752457 7:125593716-125593738 CCAAAGTCCTAGGCAGACAAGGT No data
Right 1031752460 7:125593736-125593758 GGTCTAAGGACTAGAACTTCAGG No data
1031752459_1031752460 -10 Left 1031752459 7:125593723-125593745 CCTAGGCAGACAAGGTCTAAGGA No data
Right 1031752460 7:125593736-125593758 GGTCTAAGGACTAGAACTTCAGG No data
1031752453_1031752460 4 Left 1031752453 7:125593709-125593731 CCACCTCCCAAAGTCCTAGGCAG No data
Right 1031752460 7:125593736-125593758 GGTCTAAGGACTAGAACTTCAGG No data
1031752455_1031752460 -2 Left 1031752455 7:125593715-125593737 CCCAAAGTCCTAGGCAGACAAGG No data
Right 1031752460 7:125593736-125593758 GGTCTAAGGACTAGAACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031752460 Original CRISPR GGTCTAAGGACTAGAACTTC AGG Intergenic
No off target data available for this crispr