ID: 1031753661 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:125611413-125611435 |
| Sequence | TCTACTATGTGGCCACTTCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1031753661_1031753664 | 22 | Left | 1031753661 | 7:125611413-125611435 | CCCAGAAGTGGCCACATAGTAGA | No data | ||
| Right | 1031753664 | 7:125611458-125611480 | GAGAGAGAGTGCAGTGATTATGG | No data | ||||
| 1031753661_1031753665 | 23 | Left | 1031753661 | 7:125611413-125611435 | CCCAGAAGTGGCCACATAGTAGA | No data | ||
| Right | 1031753665 | 7:125611459-125611481 | AGAGAGAGTGCAGTGATTATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1031753661 | Original CRISPR | TCTACTATGTGGCCACTTCT GGG (reversed) | Intergenic | ||