ID: 1031753661

View in Genome Browser
Species Human (GRCh38)
Location 7:125611413-125611435
Sequence TCTACTATGTGGCCACTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031753661_1031753664 22 Left 1031753661 7:125611413-125611435 CCCAGAAGTGGCCACATAGTAGA No data
Right 1031753664 7:125611458-125611480 GAGAGAGAGTGCAGTGATTATGG No data
1031753661_1031753665 23 Left 1031753661 7:125611413-125611435 CCCAGAAGTGGCCACATAGTAGA No data
Right 1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031753661 Original CRISPR TCTACTATGTGGCCACTTCT GGG (reversed) Intergenic