ID: 1031753662

View in Genome Browser
Species Human (GRCh38)
Location 7:125611414-125611436
Sequence CTCTACTATGTGGCCACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031753662_1031753665 22 Left 1031753662 7:125611414-125611436 CCAGAAGTGGCCACATAGTAGAG No data
Right 1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG No data
1031753662_1031753664 21 Left 1031753662 7:125611414-125611436 CCAGAAGTGGCCACATAGTAGAG No data
Right 1031753664 7:125611458-125611480 GAGAGAGAGTGCAGTGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031753662 Original CRISPR CTCTACTATGTGGCCACTTC TGG (reversed) Intergenic
No off target data available for this crispr