ID: 1031753662 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:125611414-125611436 |
Sequence | CTCTACTATGTGGCCACTTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1031753662_1031753664 | 21 | Left | 1031753662 | 7:125611414-125611436 | CCAGAAGTGGCCACATAGTAGAG | No data | ||
Right | 1031753664 | 7:125611458-125611480 | GAGAGAGAGTGCAGTGATTATGG | No data | ||||
1031753662_1031753665 | 22 | Left | 1031753662 | 7:125611414-125611436 | CCAGAAGTGGCCACATAGTAGAG | No data | ||
Right | 1031753665 | 7:125611459-125611481 | AGAGAGAGTGCAGTGATTATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1031753662 | Original CRISPR | CTCTACTATGTGGCCACTTC TGG (reversed) | Intergenic | ||