ID: 1031753663

View in Genome Browser
Species Human (GRCh38)
Location 7:125611424-125611446
Sequence GAATCTCACTCTCTACTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031753663_1031753666 24 Left 1031753663 7:125611424-125611446 CCACATAGTAGAGAGTGAGATTC No data
Right 1031753666 7:125611471-125611493 GTGATTATGGGACTTTGCATTGG No data
1031753663_1031753665 12 Left 1031753663 7:125611424-125611446 CCACATAGTAGAGAGTGAGATTC No data
Right 1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG No data
1031753663_1031753664 11 Left 1031753663 7:125611424-125611446 CCACATAGTAGAGAGTGAGATTC No data
Right 1031753664 7:125611458-125611480 GAGAGAGAGTGCAGTGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031753663 Original CRISPR GAATCTCACTCTCTACTATG TGG (reversed) Intergenic