ID: 1031753665

View in Genome Browser
Species Human (GRCh38)
Location 7:125611459-125611481
Sequence AGAGAGAGTGCAGTGATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031753662_1031753665 22 Left 1031753662 7:125611414-125611436 CCAGAAGTGGCCACATAGTAGAG No data
Right 1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG No data
1031753661_1031753665 23 Left 1031753661 7:125611413-125611435 CCCAGAAGTGGCCACATAGTAGA No data
Right 1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG No data
1031753663_1031753665 12 Left 1031753663 7:125611424-125611446 CCACATAGTAGAGAGTGAGATTC No data
Right 1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG No data
1031753660_1031753665 24 Left 1031753660 7:125611412-125611434 CCCCAGAAGTGGCCACATAGTAG No data
Right 1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031753665 Original CRISPR AGAGAGAGTGCAGTGATTAT GGG Intergenic
No off target data available for this crispr